QUESTION IMAGE
Question
this dna sequence will code for _____ codons. tactgatcgacccccataatgaaaatt
○ 7
○ 1
○ 9
○ 27
○ 6
Step1: Count the number of nucleotides
The DNA sequence is TACTGATCGACCCCCATAATGAAAATT. Let's count the number of nucleotides (each letter is a nucleotide). Let's list them: T, A, C, T, G, A, T, C, G, A, C, C, C, C, C, A, T, A, A, T, G, A, A, A, A, T, T. Wait, let's count again carefully:
T (1), A (2), C (3), T (4), G (5), A (6), T (7), C (8), G (9), A (10), C (11), C (12), C (13), C (14), C (15), A (16), T (17), A (18), A (19), T (20), G (21), A (22), A (23), A (24), A (25), T (26), T (27). Wait, no, maybe I made a mistake. Wait the sequence is: T A C T G A T C G A C C C C C A T A A T G A A A A T T. Let's group them:
Wait, let's write the sequence as a string: "TACTGATCGACCCCCATAATGAAAATT"
Let's count the length: Let's see, T(1),A(2),C(3),T(4),G(5),A(6),T(7),C(8),G(9),A(10),C(11),C(12),C(13),C(14),C(15),A(16),T(17),A(18),A(19),T(20),G(21),A(22),A(23),A(24),A(25),T(26),T(27). Wait, 27 nucleotides? But codons are groups of 3 nucleotides. Wait, but maybe the start codon is AUG (in mRNA, but DNA is TAC which is the template for AUG). Wait, no, the question is about DNA coding for codons. Wait, actually, a codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or stop signal during protein synthesis. So the number of codons is the number of nucleotides divided by 3.
Wait, let's count the number of nucleotides in the given DNA sequence:
Let's write the sequence: T A C T G A T C G A C C C C C A T A A T G A A A A T T
Let's count each character:
- T
- A
- C
- T
- G
- A
- T
- C
- G
- A
- C
- C
- C
- C
- C
- A
- T
- A
- A
- T
- G
- A
- A
- A
- A
- T
- T
Wait, that's 27 nucleotides? But 27 divided by 3 is 9. Wait, but maybe I miscounted. Wait, let's check the sequence again: "TACTGATCGACCCCCATAATGAAAATT"
Let's split into groups of 3:
TAC TGA TCG ACC CCC ATA ATG AAA ATT
Wait, let's count the number of triplets:
- TAC
- TGA
- TCG
- ACC
- CCC
- ATA
- ATG
- AAA
- ATT
Wait, that's 9 triplets. Wait, but let's count the number of nucleotides: each triplet is 3, so 9*3=27. So the number of codons is 9.
Wait, but the original selected option was 1, which is wrong. Let's re-express:
The DNA sequence is: T A C T G A T C G A C C C C C A T A A T G A A A A T T
Let's count the length: Let's see, T(1),A(2),C(3),T(4),G(5),A(6),T(7),C(8),G(9),A(10),C(11),C(12),C(13),C(14),C(15),A(16),T(17),A(18),A(19),T(20),G(21),A(22),A(23),A(24),A(25),T(26),T(27). So 27 nucleotides. Number of codons = number of nucleotides / 3 = 27 / 3 = 9. So the correct answer should be 9.
Step1: Count the number of nucleotides in the DNA sequence.
The DNA sequence is "TACTGATCGACCCCCATAATGAAAATT". Let's count the characters:
T (1), A (2), C (3), T (4), G (5), A (6), T (7), C (8), G (9), A (10), C (11), C (12), C (13), C (14), C (15), A (16), T (17), A (18), A (19), T (20), G (21), A (22), A (23), A (24), A (25), T (26), T (27). So there are 27 nucleotides.
Step2: Calculate the number of codons.
Since a codon consists of 3 nucleotides, the number of codons is the total number of nucleotides divided by 3.
Number of codons = $\frac{27}{3}$ = 9.
Snap & solve any problem in the app
Get step-by-step solutions on Sovi AI
Photo-based solutions with guided steps
Explore more problems and detailed explanations
9 (So the correct option is the one with 9, e.g., if the options are as given, the correct answer is the option with 9, like "9" or "C. 9" depending on the option labels, but in the given options, the third option is 9, so the answer is 9.)