生物
細胞生物學、遺傳學、生態學與生命科學基礎。
-
7 multiple choice 1 point predation is considered a limiting factor bec…
A. It controls prey population size ### Question 8
-
read the passage. there are several questions about this passage. from …
3. It reveals when the author first started to take notice of what happens during springtime.
-
in which phase of the cell cycle is deoxyribonucleic acid replicated? ○…
Synthesis phase
-
what does douglass say is the reason for separating enslaved children f…
According to Frederick Douglass, the reason for separating enslaved children from their mothers was to break the maternal bond, reduce the development of strong family ties and a …
-
read the passage. there are several questions about the passage from fi…
1. "I look forward to having a houseful of young poets again" (Paragraph 2)
-
read the passage. there are several questions about this passage: from …
4. The author sees the importance of sharing her enthusiasm for spring with friends.
-
which of the following is a function of proteins in cells? options: hor…
Enzyme activity
-
quiz 1: setting up an experiment - y which of the following is not an e…
A. An essay about cell phones
-
what is the monomer of proteins? 6/10 question 6 options: amino acid, n…
Amino acid (assuming the green bar option is amino acid, as the visible text on the green bar seems to start with "amino acid" based on the image).
-
2. name two farming inventions from the agricultural revolution.
1. Seed Drill (invented by Jethro Tull, allowed efficient seed sowing). 2. Iron Plow (more durable and effective for tilling soil).
-
post-assessment question 1 of 10 which of these is an example of intern…
C. Values
-
which three parts of this excerpt from nathaniel hawthorne’s novel the …
1. he was ready to encounter an evil spirit on his own ground 2. Endowed with common sense, as massive and hard as blocks of granite, fastened together by stern rigidity of purpos…
-
read the entry from an english usage guide. the word terrific comes fro…
Half a mile beneath its placid surface, the sea seethed and churned from a terrific volcanic eruption.
-
henry clay gained a reputation for staving off disagreements eventually…
the U.S. Civil War
-
which of the following describes the evolution of the slavery debate pr…
B. It was settled and disputed mostly along geographical lines. (Assuming the middle option is B; adjust identifier if needed based on actual labeling.)
-
question 10. in 1953 stanley miller and harold urey designed an experim…
A. The process of synthesizing organic molecules from a mixture of gases has been successfully modeled in the laboratory many times
-
question 8. lemurs bodies are adapted to efficiently store energy for t…
B. Lipids
-
question 7. a florist places a bouquet of white carnations in water con…
C. Cohesion and adhesion of water molecules
-
question 6. what evidence strongly suggests that life on earth originat…
B. The ancestors of today's prokaryotes are most closely related to the bacteria that live on the deep - sea vents.
-
9/9 hw: nature walk 100 points add class comment homework: ature walk\:…
The subfield is Biology (under Natural Science).
-
question 5. water has a much higher specific heat than most other coval…
D. Organisms that are sensitive to changes in temperature would die
-
quiz 1: setting up an experiment - y the variable affects the variable.…
The independent variable affects the dependent variable.
-
from tallgrass prairie national preserve, kansas 1. tallgrass prairie n…
2. Paragraph 2 describes what the prairie is like today and paragraph 3 explains the way the landscape formed
-
quiz 1: setting up an experiment - y ms. maskwe is designing a test to …
Thermometer used to measure temperature, Amount of time tested, Starting temperature, Room temperature where the water bottle is located, Type of drink, Amount of drink
-
before industrial revolution\tafter industrial revolution most people l…
The Enclosure Movement was the consolidation of common lands into private, larger farms by landowners. It was important as it boosted agricultural efficiency (enabling new farming…
-
read the excerpt from the joint statement by president roosevelt and pr…
D. all countries will cooperate to achieve common goals with regard to the world economy.
-
which of the following describes the evolution of the slavery debate pr…
It was settled and disputed mostly along geographical lines.
-
question 4. graph with ph axis (5.0, 5.8, 6.6, 7.4, 8.2, 9.0) and verti…
D. The enzyme’s activity is greater around pH 8.0 than around pH 5.0
-
question 3. 1\tamino acids\treaction catalyst 2\tfatty acids\tmembrane …
A. 3
-
e correction definition for negative phototropism and positive phototro…
growth towards sunlight
-
according to the text, what are the monomers of carbohydrates? a. monos…
A. Monosaccharide
-
5 the first producers of energy-rich compounds that can be used later b…
D. Primary Producer
-
according to the text, which molecule is known as a structural carbohyd…
A. Cellulose
-
plant hormones quick... from the drop down pick the correction definiti…
Negative phototropism is growth away from sunlight, Positive phototropism is growth towards sunlight
-
the side of the body between the ribs and ilium is the ______. ○ a. kne…
d. flank
-
ms. wnek is conducting an experiment to test the following lab question…
Grow location, Amount of water, Amount of light
-
research ________ involves adjusting or falsifying data to achieve a de…
misconduct ### Sub - question 2
-
definite articles and indefinite articles definite articles in english …
s: 1. La 2. La 3. El 4. La 5. El 6. El 7. La 8. El (or La, depending on gender; but if we assume masculine, "el"; if feminine, "la")
-
how does auxin affect the growth of plant stems? (1 point) it builds up…
It builds up on the side of the stem that is away from the light source and stimulates growth.
-
the second incisors of equine are called ______. ○ a. nippers ○ b. cutt…
b. cutters
-
quiz 1: setting up an experiment - y review the model. anatomy of the h…
it simplifies a complex topic
-
4 process that uses energy from the sun to convert carbon dioxide (co₂)…
D. Photosynthesis
-
use the scenario to answer the question. you investigate the effect of …
the concentrations of ethylene spray
-
ms. wnek is conducting an experiment to test the following lab question…
C. Seed brand
-
which statement is true? (1 point) abscisic acid regulates water loss i…
B. Abscisic acid regulates water loss in plants by making plants close their stomata during hot weather.
-
based on the following selection, a firefighter who wants to work in fr…
C. International Fire Service Accreditation Congress
-
directions: use the diagram to the right to answer questions 65 - 78. 6…
Carbon ### Question 66
-
distinct deserts 1 say the word desert and most people imagine an extre…
3. Each paragraph describes the characteristics of one type of desert environment.
-
3 trees, grass, weeds and flowers are all examples of what a photosynth…
B. Primary Producers
-
cold deserts snow in the desert? it seems impossible doesnt it? cold or…
4. spread throughout
-
use this scenario to answer the question. after eating half of a banana…
The polyvinyl wrap probably caused the browning since it traps ethylene gas which would speed up the ripening process.
-
2 classify each organism as a producer, consumer or decomposer. | | pro…
To solve this, we analyze each organism based on their role in the ecosystem: ### Bacteria - Decomposers break down dead matter. Many bacteria act as decomposers (some are produce…
-
in 1953, james watson and francis crick established the structure of dn…
deoxyribose nucleic acid ### Question 3
-
how did the economic policies of the early 19th century, such as the am…
D. by fostering national economic growth through protective tariffs, a national bank, and internal improvements
-
1 most humans are considered a herbivores b carnivores c omnivores d au…
C. Omnivores
-
quiz 1: setting up an experiment - y ms. hink is conducting an experime…
C. Tomato weight
-
what conflict was the first major international test of the sovereignty…
C. the War of 1812
-
dna replication before a cell divides, its dna is replicated (duplicate…
To ensure that after cell division, each new cell ends up with a complete set of DNA (genetic instructions) so the cell can function properly and divide again in the future. ### Q…
-
the image shows a scene in st. petersburg. regarding the action taking …
“Before ‘Bloody Sunday’”
-
connecting multiple electrochemical cells (lemons) together one after a…
A. more
-
russian revolution after the russian revolution, each city in russia ha…
soviet.
-
label the photomicrograph of the sebaceous gland. basal cell duct of se…
Top to bottom (matching the order of the labeling lines): 1. Hair follicle 2. Duct of sebaceous gland 3. Basal cell 4. Sebaceous gland 5. Secretory cell
-
which of the following would be the correct anticodon for the second tr…
ACU (the option with ACU, e.g., the option labeled as ACU in the multiple - choice list) ### Second Question (The second codon transcribed)
-
russian revolution what marked the end of the russian monarchy? the rus…
the Russian Revolution
-
what marked the end of the russian monarchy? the russian civil war the …
B. the Russian Revolution
-
read the quotation from the declaration of independence. \for depriving…
A. Due process of law was implemented.
-
translation after the mrna has been transported to the ribosomes, it bi…
The tRNA (via its anticodon, which is complementary to the mRNA strand) and the ribosome (which binds to the mRNA strand to read its sequence) connect to the mRNA strand. (Primari…
-
which option describes one reason europeans were able to gain dominance…
B. European diseases killed many people in the Americas
-
what is it about the way people are socialized that makes people most l…
direct instruction from parents (Note: Wait, correction. The correct reasoning: Wait, actually, the most accurate in terms of socialization's role in adopting political ideology—w…
-
which happened after the october revolution? vladimir lenin took power.…
A. Vladimir Lenin took power.
-
this dna sequence will code for _____ codons. tactgatcgacccccataatgaaaa…
9 (So the correct option is the one with 9, e.g., if the options are as given, the correct answer is the option with 9, like "9" or "C. 9" depending on the option labels, but in t…
-
russian revolution which led to the 1905 revolution? the events in st. …
the events in St. Petersburg
-
what was the outcome of the 1917 october revolution? the bolsheviks lau…
The Bolsheviks launched a coup d'etat against the government.
-
multiple choice: 63. in a food web, which type of organism receives ene…
(c) decomposers ### Question 64
-
what is a key criticism of the mercator projection regarding africa? * …
A. It makes Africa seem marginalized ### Second Question:
-
continued passages a subtropical desert is the driest desert people thi…
4. Namib
-
the declaration of independence is considered the first formal assertio…
B. self - government.
-
what caused the february revolution of 1917? people were angry because …
- People were angry because of the tsar’s poor leadership. - The Duma rose up against the autocratic Russian monarchy. - Protests against food and coal shortages turned into riots.
-
what type of animal is el cadejo? (1 point) cat dog horse bird
B. dog
-
say the word desert and most people imagine an extremely dry, desolate …
2. There are different kinds of deserts all over the world
-
where is dna stored in eukaryotic cells? options: cell membrane, mitoch…
D. Nucleus (assuming the options are labeled as A. Cell membrane, B. Mitochondria, C. Cytoplasm, D. Nucleus)
-
which nitrogen base pairs with cytosine in dna? options: guanine, thymi…
Guanine (assuming the first option was a typo and should be guanine; if the first option is indeed "guanine" as a typo - corrected version, then the correct option is the first on…
-
russian revolution which were lenin’s actions before and during the rus…
- He opposed the tsar and was exiled. - He led the Bolsheviks. - He supported the ideology of Marxism. - He opposed the provisional government.
-
what can studying extracted dna tell us about an organism? it can revea…
It can reveal genetic information about the organism.
-
part a drag the organelles to the appropriate bins. organelle labels (p…
To solve this, we analyze the organelles and their presence in cell types: ### Animal cells only: - **Centrioles**: Involved in cell division, unique to animal cells (and some low…
-
comparing the rise and fall of empires made the empire weaker militaril…
B. Alexander ruled essentially the same territory and in the same way that the Persians had.
-
speaker 1: now that we are independent, americans should create a gover…
B. Speaker 2
-
can you spot the scientific method? each sentence below describes a ste…
B. form a hypothesis ### 2.
-
what is unique about the active site of an enzyme? after an enzyme cata…
The active site has a specific 3D shape (complementary to its substrate, via lock - key/induced - fit) and chemical properties to bind a specific substrate and catalyze a reaction…
-
(f) suggest one hazard the students should be aware of when collecting …
One hazard students should be aware of is slipping on slippery rocks (due to algae or wet surfaces), which can cause falls and injuries. (Other valid answers: strong waves, changi…
-
a population of bacteria may evolve resistance to a drug over time. thi…
B ### Part B
-
part 2: fill in the blanks with the right word use these words: evolve,…
DNA ### 2.
-
question 4 1 pts one natural cause of extinction would be the massive _…
C. Volcano (assuming the options are labeled A: Ice age, B: Asteroid, C: Volcano)
-
which of the following contributes the least to the problem of antibiot…
taking the entire course of antibiotics as prescribed by the doctor ### Part 2 (Continued antibiotic application result?):
-
russian revolution which led to the 1905 revolution? the events in st. …
the events in St. Petersburg
-
view passage 1 from the power of nonviolence, a speech by martin luther…
By humiliating your opponent, you ultimately cannot achieve the goal of social change.
-
think about everything you have learned in this lesson why did revoluti…
- Famine spread as peasants left the fields to fight for the Russian military - The Russian monarch was ineffective and would not help his people - World War I resulted in a high …
-
the graphic organizer shows options for face-to-face help for academic …
D. Educators
-
part a over time, bacteria have become increasingly resistant to antibi…
B. Bacteria that happen to have natural resistance to antibiotics survived and reproduced. ### Part B
-
question 10 of 10 what is one distinguishing characteristic of a myth? …
B. Supernatural creatures, such as gods