Sovi.AI - AI Math Tutor

Scan to solve math questions

QUESTION IMAGE

1. a. click on enter or edit dna and copy this code: atgccagggcggagagct…

Question

  1. a. click on enter or edit dna and copy this code: atgccagggcggagagctaa

b. proceed through the steps of transcription and translation using the buttons at the bottom of the screen.
2.

  1. edit the dna by changing the 4th base to g

new sequence: atggccagggcggagagctaa
check the new protein created by your new dna. write the new amino - acid chain.
describe how this changed the protein from the original.

Explanation:

Brief Explanations

The problem involves DNA - related tasks such as editing DNA sequence and determining the resulting amino - acid chain. This is related to molecular biology concepts. First, the DNA sequence is edited as instructed. Then, through the processes of transcription and translation (using the buttons as guided), the new amino - acid chain can be determined. Changes in DNA bases can lead to different amino - acids being incorporated into the protein chain, potentially altering the protein's structure and function.

Answer:

  1. First, change the 4th base of the DNA sequence ATGGCAGGGCGGAGAGCTAA to G, getting ATGGCGGGGCGGAGAGCTAA.
  2. Then, proceed through the steps of transcription and translation using the buttons at the bottom of the screen as described in step B.
  3. Click on each amino - acid to see its highlighted name and write the sequence of amino - acids shown when the protein is completed.
  4. Describe how this change affected the protein from the original by comparing the new and old amino - acid chains and considering how changes in amino - acids can impact protein structure and function.