Question

1. explain the significance of the last triplet (taa) in the sequence:
2. edit the dna by changing the 4th base to g

new sequence: atggcaggcggcgagagctaa
check the new protein created by your new dna.write the new amino acid chain.

Explanation:

For Question 5:

TAA is a stop codon. During translation, when the ribosome encounters this triplet, it terminates the synthesis of the protein chain, preventing the addition of further amino acids.

For Question 6:

1. First, modify the 4th base of the given DNA sequence: original 4th base is C, change to G, resulting in the new DNA sequence: ATGGAGGGCGGAGAGCTAA
2. Transcribe the DNA to mRNA (replace T with U): AUGGAGGGCGGAGAGCUAA
3. Split the mRNA into codons (triplets): AUG, GAG, GGC, GGA, GAG, CUA, AA
4. Translate each valid codon to amino acids using the standard genetic code:

• AUG = Methionine (start codon)
• GAG = Glutamic acid
• GGC = Glycine
• GGA = Glycine
• GAG = Glutamic acid
• CUA = Leucine
• The final AA is an incomplete codon, so it is not translated.

Answer:

1. For Question 5: TAA is a stop codon; it signals the ribosome to stop synthesizing the protein chain, ending translation.
2. For Question 6:

• Modified DNA sequence: ATGGAGGGCGGAGAGCTAA
• Amino acid chain: Methionine - Glutamic acid - Glycine - Glycine - Glutamic acid - Leucine