Question

look at the highlighted condons on the mrna. use the menus to select the proper base pairs and make the anticodons. 5 mrna 3 gaucuaaguaaugccggaauacuagccu done auc cua uac cuu intro

Explanation:

Step1: Recall base - pairing rules

In RNA, A pairs with U and G pairs with C. Anticodons are complementary to mRNA codons and read in the 3' - 5' direction while mRNA is read 5' - 3'.

Step2: Analyze first highlighted codon

The first highlighted mRNA codon is AUG. Its complementary anticodon (read 3' - 5') is UAC.

Step3: Analyze second highlighted codon

The second highlighted mRNA codon is GAA. Its complementary anticodon (read 3' - 5') is CUU.

Step4: Analyze third highlighted codon

The third highlighted mRNA codon is UAG. Its complementary anticodon (read 3' - 5') is AUC.

Answer:

First anticodon: UAC
Second anticodon: CUU
Third anticodon: AUC