Biología
Biología celular, genética, ecología y fundamentos de ciencias de la vida.
-
crocodiles, lizards, and snakes are all reptiles. however, lizards are …
C. Lizards and snakes are more alike since both species have a recent common ancestor.
-
charles darwin was credited for writing the biological theory of ______…
C. evolution by natural selection, Galapagos finches
-
on a scale of 1-4, how confident are you about the functions of the cel…
This is a self - assessment question. One would choose an option (1 - 4) based on their actual confidence level. For example, if a student feels very confident, they would choose …
-
analyze the cellular composition of a heart muscle cell versus a fat st…
D. Because heart cells have a constant high energy demand for contraction, which mitochondria supply via ATP. (assuming the last option is D; if the options were labeled A - D wit…
-
a certain toxin destroys the centrioles within a cell. what is the most…
B. The cell will be unable to divide to create new cells.
-
describe the correct pathway for a protein that is destined to be secre…
A. Ribosome on Rough ER -> Golgi Apparatus -> Vesicle -> Cell Membrane
-
side-splotched lizards, uta stansburiana, are a type of lizard found in…
B. when the color morphs can no longer breed with each other
-
what is the key difference in the primary function of lysosomes versus …
Lysosomes digest waste and old organelles, while peroxisomes neutralize specific toxic compounds. (The teal - colored option, assuming the full option is as described in the expla…
-
which of these provides structural support for a plant cell, and is not…
C. Cell Wall
-
the bones in the front limbs of many mammals are similar in their struc…
D. homologous structures
-
which organelle is primarily responsible for breaking down damaged orga…
A. Lysosome
-
name:_______________________________period:_________ word bank simile, …
Onomatopoeia; sound 2.
-
which statement correctly compares mitochondria and chloroplasts? chlor…
D. Both are involved in energy conversion and contain their own DNA.
-
according to darwins theory of evolution, which organisms are best able…
D. organisms that possess overall characteristics best suited to their environment
-
what is the main role of the golgi apparatus? breaking down waste mater…
Modifying, sorting, and packaging proteins and lipids for delivery.
-
a cell that produces large amounts of steroid hormones would likely hav…
B. Smooth ER
-
what is the primary function of the nucleolus? to store the cells dna. …
D. To act as a factory for producing ribosomes. (Note: Assuming the options are labeled A - D with A being the first (yellow), B the second (blue), C the third (orange), D the fou…
-
what is the primary function of the nucleolus? to store the cells dna. …
The correct option (assuming the last option is "To act as a factory for producing ribosomes") is the fourth option: To act as a factory for producing ribosomes.
-
what is the primary difference between cytoplasm and cytosol? cytosol i…
A. Cytosol is the fluid part of the cytoplasm, which also includes the organelles.
-
how do passages 1 and 2 use the same evidence to develop opposing argum…
Passage 1 uses MRI scans to show that stimulus produced by the brain proves that love is a biological concept. Passage 2 uses MRI scans to show that the same area of the brain pro…
-
passage 2: romantic love is a fairy tale 1 some people truly believe th…
These studies are not reliable; even many scientists are skeptical about their results.
-
evaluate the historical significance of shays rebellion in shaping the …
D. It convinced leaders to create a new constitution with a stronger federal government
-
in what order do the electrons move through the electron transport chai…
b) Water - photosystem II - photosystem I - NADPH
-
where is the light energy converted into an electron flow? a) within th…
d) In the reaction center chlorophyll
-
where does the light reaction of photosynthesis take place? a) in the c…
d) In the thylakoid membrane
-
read the following excerpt from passage 1, paragraph 8: jo boaler, math…
It supports the argument that shifting toward problem - solving instruction can help students find an alternative way to learn math.
-
5. the double helix model of dna explained chargaffs rules because a. a…
A. adenine could hydrogen-bond with thymine and guanine could hydrogen-bond with cytosine to hold the helix together.
-
analyzing dna structure 4. watson and crick made a successful model of …
C. a double helix with bases inside the helix.
-
3. an important clue to the structure of dna was provided by a. a prote…
B. an X-ray diffraction photograph of DNA.
-
which of the following is the correct definition of photosynthesis? a) …
b) The process used by organisms to convert light energy to chemical energy
-
directions: for the following experiments, identify the independent var…
a. Independent Variable: Type of fertilizer (or application of fertilizer, including no fertilizer) b. Dependent Variable: Number of flowers on each bush c. Control Variable: Type…
-
analyzing dna structure 2. rosalind franklin used what technique in her…
D. X-ray diffraction
-
in our class examples, where did the arduino get its power from? a simu…
A. A simulated USB connection
-
analyzing dna structure 1. chargaffs experiments in dna analysis were c…
A. The percentages of adenine (A) and thymine (T) were always equal.
-
amoeba sisters video recap: classification 1. first things first! some …
1. Similarity: Both are living cell types. Differences: Prokaryotes have no nucleus/membrane-bound organelles; eukaryotes have a nucleus and organelles. (Left = Prokaryote, Right …
-
where does the electron flow that we measure with dcpip originate? a) p…
a) Photosystem II
-
ive heard that our principals predecessor, or the person in that job be…
b. Your great - great - grandparents.
-
multiple choice dna replication occurs with the help of several molecul…
B. enzymes
-
multiple choice what is the complementary strand for gattgc? a agttcg b…
C. CTAACG
-
match each word to its definition. material that carries information ab…
1. material that carries information about how an organism will look and function → e. DNA 2. a protein that acts as a catalyst in an organism → b. enzyme 3. small molecule used t…
-
world history | north murray high school conquest graphic organizer | |…
To fill in the "Conquest Graphic Organizer" for the remaining explorers, we analyze each: ### Bartholomew Diaz - **Country of Origin**: Portugal (born in Portugal, part of Portugu…
-
on the other side of the dig site, a fern fossil is visible in sandston…
C. The area must have had soil, sunlight, and rain 70 million years ago
-
10. people with heartburn often take antacids, medicines that lower the…
10. Yes, antacids can affect digestion, primarily by impairing protein breakdown: - Stomach acid activates pepsinogen to pepsin (the main protein-digesting enzyme); reduced acidit…
-
practice: transcribing and translating transcribe and translate the fol…
mRNA: AUGGCCUACGGUCUAGUUUAG amino acids: Met, Ala, Tyr, Gly, Leu, Val, Stop ### Problem 2:
-
reproductive isolation worksheet use the options below to identify whic…
Type of Reproductive Isolation: Geographic Isolation
-
12 the diploid number of a cell is 16. what is its haploid number? 13 t…
1. 8 2. 18 3. Gametes are haploid (have one set of chromosomes, used for sexual reproduction), while most other animal cells are diploid (have two paired sets of chromosomes, func…
-
what can rock layers tell us about earths history? what comes to mind w…
Rock layers are a tangible record of Earth's deep history: they preserve fossilized remains of long-extinct species that reveal the evolution of life, chemical and isotopic compos…
-
if you look under a microscope and see distinct chromosomes in a cell, …
No, the cell is not in interphase. In interphase, genetic material is in the form of uncondensed chromatin, not distinct, visible chromosomes; condensed chromosomes only appear du…
-
there is no scientific consensus on why we yawn. one theory argues that…
the exact scientific reason for yawning
-
d. nucleosomes. protein synthesis is occurring in a ribosome. is this a…
Translation
-
use the information from the table to answer the question. greek roots …
kinesiology
-
chromosomes inside the nucleus that are paired with others of similar s…
a. homologs.
-
the roman empire, han dynasty, and gupta empire all followed a similar …
### Similar Empire Pattern - Each formed when several **independent** regions united. - Each thrived for **hundreds** of years. - Each fell due to a combination of outside **invad…
-
geology is the study of earths rocks, landforms, history, and the force…
- Processes that form rocks and minerals - The structure of Earth's layers - Past climates and life forms
-
a dna strand has the following sequence of nucleotides: t-a-c-g-c-a-a-t…
a. $A-U-G-C-G-U-U-A-C-G-G-U-U-A-A$ b. 5 c. 4 amino acids: Methionine, Arginine, Tyrosine, Glycine
-
e. mitosis what is one disorder in the body where some cells no longer …
d. cancer
-
during the cell cycle, when is dna replicated? a. $g_1$ b. s c. $g_2$ d…
b. S
-
2 in nucleic acids dna and rna, the backbone is made up of a. nitrogeno…
c. sugars and phosphates.
-
4. watch the biointeractive short film the making of the fittest: natur…
To solve this, we follow these steps: ### Step 1: Watch the Film View *The Making of the Fittest: Natural Selection and Adaptation* to gather information on mouse fur color, natur…
-
name: directions: use the clues below to fill in the crossword puzzle. …
To solve the crossword puzzle, we analyze each clue: ### ACROSS Clues: 1. **Animals without eyes, mouth, or organs**: Likely a simple organism like *sponge* (but check length; the…
-
which situation is an example of competition that could be found in the…
B. two lion populations utilize the same gazelle population as their main food source
-
which choice is likely to result in the most competition? organisms tha…
organisms that use the same resource
-
which organism provides energy to all other organisms in this ecosystem…
prairie grass
-
which item is an example of a producer? sun fern chestnut ant
○ fern
-
what is a key element found in all carbohydrates, lipids, proteins, and…
carbon
-
which place describes a community? the desert a forest of birds, insect…
a forest of birds, insects, and squirrels
-
which choice is an abiotic factor of an ecosystem? ants minerals dogs f…
B. minerals
-
which action is a response to external stimuli? eating when hungry wear…
B. wearing sunglasses to protect eyes from UV rays
-
which statement describes a response to external stimuli? a rabbit runs…
a. a rabbit runs away from a fox that is chasing it
-
which statement is true? plant cells are unaffected when water is scarc…
D. Some substances must be dissolved in water before they can be used.
-
4. lucy is looking at a cell under a microscope. the size of the actual…
B) 5 mm
-
instrucciones: escoge la mejor alternativa. 1. yo no ______ ir a la fie…
b. pude ### Question 2
-
how many syllables does the word opportunity have? (1 point) 4 5 3 6 wh…
5 (the option with 5) ### Second Question:
-
2. nathan hales failed mission ultimately had no impact on the revoluti…
## True/False (Corrected): 2. False 3. False ## Fill in the Blank (Corrected): 1. Secret agents who gather information for their country during wartime are called **spies** 2. A f…
-
digestive system reflection choose the three main structures of the dig…
1. Stomach: Initiates protein digestion, mixes food into chyme, and regulates food release to the small intestine. 2. Small Intestine: Site of most nutrient absorption (via villi/…
-
quick action: inb the endocrine system use the word bank below to label…
To regulate body processes by secreting hormones into the bloodstream (or similar accurate description of the endocrine system's main function, e.g., "Produce and secrete hormones…
-
quick action: inb the endocrine system match it up: create four rectang…
- Pituitary Gland - Controls the function of most other endocrine glands - Pineal Gland - Helps regulate sleep patterns - Thyroid Gland - Regulates growth and the rate of chemical…
-
last look the endocrine system drag each card to its correct location. …
To solve this drag - and - drop task about the endocrine system, we analyze each element: ### Glands Column - **Image**: The diagram showing various endocrine glands (like pituita…
-
excretory system reflection compare the excretory system to a water sli…
To solve this fill - in - the - blank problem about the excretory system, we need to recall the structure and function of each part of the excretory system. ### Step 1: First blan…
-
select the correct answer. which cabinet department did jimmy carter es…
A. Department of Energy
-
which of these is true for a voltaic cell? the reaction is non - sponta…
D. There will be two separate compartments.
-
which nutritional class builds and maintains cells and tissues? fats wa…
C. proteins
-
which of these nutrients helps the body absorb vitamins and sustain the…
C. fats
-
labeling cellular respiration directions: correctly label where the dif…
- "Area Outside Organelle" → Cytoplasm - "Reaction Name" (hexagon) → Glycolysis - Mitochondrial intermembrane region → Intermembrane Space - Inner mitochondrial compartment → Matr…
-
step 3 - the etc the final step of cellular respiration is the electron…
electron transport chain (ETC); chemiosmosis ### Question 34
-
name: riz malek username: riz555 following: 872 users followers: 12,005…
- the biography - the most recent post - the number of followers
-
step 2 - krebs cycle 30. in the krebs cycle, \\square atp and \\square …
s: 30. 2 ATP and 6 NADH (or if per turn, 1 and 3; but based on two acetyl - CoA, 2 and 6) 31. carriers 32. 4 more, total 6
-
which of the following best defines the term \diploid\? it is a cell th…
They are two sets of chromosomes, one from each parent.
-
what role do histones play in chromosome structure? they replicate dna …
They help package DNA into a compact structure.
-
which of the following best defines chromatin? unpackaged, readable dna…
packaged, unreadable DNA
-
what is the function of the centromere? to bond sister chromatids to re…
to bond sister chromatids
-
which of the following best describes gene locus? a type of gene a muta…
C. a specific location of a gene
-
what is the most primitive method of cell division? binary fission frag…
A. binary fission
-
each of the images below represents one of the 3 reasons your body migh…
1. Top image: Growth (producing cells to increase body size) 2. Middle image: Repair (producing cells to heal an injury) 3. Bottom image: Replacement (producing cells to replace w…
-
28. the _________________ controls both systems. if you disrupt the ner…
nervous system ### Question 29:
-
22. cardiac (or heart) trauma, blockage (heart attack) that can cause t…
To solve these fill - in - the - blank questions, we analyze each one based on biological concepts related to human body systems: ### Question 22 The heart can experience trauma, …
-
the m.e. will document their findings on a diagram to show where each p…
begin the internal examination (or move the body to the autopsy table) ### Question 19:
-
what is the purpose of cellular renewal? to create genetically diverse …
to replace worn-out cells
-
which of the following is a purpose for cell division? rejuvenation rel…
replacement
-
what can fragmentation, a very rare form of reproduction be characteriz…
part of an organism pinching off and becoming its own organism