cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. below is a table showing the amino acid sequences for cytochrome c in several organisms.
table with columns: organisms (amoeba, kangaroo, earthworm, cat, shark, dolphin, lizard, sponge) and biochemical data (amino acid sequence, dna sequence) for each organism
cladograms
1. the more amino acids an organism has in common, both in type and order, the closer the relationship between organisms. the same is true for nucleotides (the code for dna). compare the biochemical data above. which organism is most closely related to the lizard?
2. why did you choose that organism?
3. which organism is most closely related to the dolphin?
4. why did you choose that organism?
5. how do you think different amino acid sequences would affect organisms?

Question

Accepted Answer

### Question 1
# Explanation:
## Step1: Analyze Lizard's sequences
Lizard's amino acid sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG
Lizard's DNA sequence: CTAAATCCCCGCGTTTATCGTAGTTTCCGGTGTAGTTCGT

## Step2: Compare with other organisms
- Shark's amino acid sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG (matches Lizard's aa sequence)
- Shark's DNA sequence: CTTATCCCCCGCGTTTATCGTAGTTTCCCGTGTACTTCGT (similar to Lizard's DNA, few differences)
- Other organisms (e.g., Kangaroo, Cat, Dolphin) have more differences in aa/DNA sequences.

# Answer: Shark

### Question 2
# Brief Explanations:
The Lizard and Shark have the **same amino acid sequence** (type and order of amino acids) and very similar DNA sequences. The more common amino acids (and nucleotides) between organisms, the closer their relationship.

# Answer: Because the Lizard and Shark have identical amino acid sequences and highly similar DNA sequences, indicating a close evolutionary relationship.

### Question 3
# Explanation:
## Step1: Analyze Dolphin's sequences
Dolphin's amino acid sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-HIS-VAL-VAL-SER
Dolphin's DNA sequence: CTAAATCCCCGCGTTTATGGTAGTTTCCCATGTAGTAAGT

## Step2: Compare with other organisms
- Cat's amino acid sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-HIS-LEU-LEU-SER (most similar aa sequence to Dolphin: differs only in the last two "VAL-VAL" vs "LEU-LEU")
- Cat's DNA sequence: TTAATCCCCCCGTTTATCGTACTTTCCCATGTACTAAGT (similar to Dolphin's DNA, few differences)
- Kangaroo: More differences in aa/DNA.

# Answer: Cat

### Question 4
# Brief Explanations:
The Dolphin and Cat have the most similar amino acid sequences (differing only in two amino acids) and relatively similar DNA sequences. Greater similarity in biochemical data (aa/DNA) implies a closer relationship.

# Answer: Because the Dolphin and Cat have the most similar amino acid sequences (only two differences) and relatively similar DNA sequences, showing a close relationship.

### Question 5
# Brief Explanations:
Amino acid sequences determine the **structure and function of proteins** (like cytochrome c). Different sequences can change the protein’s shape, stability, or interaction with other molecules. This can affect cellular processes (e.g., cellular respiration for cytochrome c), leading to differences in traits, survival, or evolutionary fitness.

# Answer: Different amino acid sequences can alter protein structure/function, affecting cellular processes, traits, and an organism’s survival or evolution.

Sovi.AI - AI Math Tutor

QUESTION IMAGE

Question

Explanation:

Question 1

Step1: Analyze Lizard's sequences

Step2: Compare with other organisms

Step1: Analyze Dolphin's sequences

Step2: Compare with other organisms

Answer:

Question 2