QUESTION IMAGE
Question
substitution (mutating) is a genetic mutation. this genetic mutation occurs when a single dna base (a in pink) is replaced with a different dna base (c in yellow). this causes a different amino acid produced, which results in a completely different protein being produced.
original dna code
dna bases—catcatcatcatcatcatcat
individual amino acids
mutated dna code replaced dna base
catgatcatcgtcatcatcat
new, different amino acid
which is the key result of this mutation?
a. creating a different protein will cause an instant termination of the organism, and it will die suddenly.
b. creating a different protein may result in neutral, beneficial, or harmful effects on the structure and function of the organism.
c. creating an abnormal, different protein is unlikely to affect the function of cells, tissue, or organs in the organism because the organism is made up of billions of proteins.
d. there is no impact to the function of the protein; only the amino acid changes.
To solve this, we analyze each option:
- Option A: A single base substitution (missense mutation here) doesn't usually cause instant termination (that's nonsense mutation with a stop codon). So A is incorrect.
- Option B: A missense mutation (changing one amino acid) can have neutral (no effect), beneficial, or harmful effects on protein structure/function, as the new amino acid's properties (like charge, size, polarity) relative to the original matter. This matches what we know about missense mutations.
- Option C: A single amino acid change in a protein doesn't necessarily "always" affect cell/tissue/organ function. Some changes are neutral. So C's "always" is wrong.
- Option D: A single base change (missense) changes one amino acid, but the protein's structure can be affected (since amino acids determine structure), so saying "no mutation" is wrong.
Snap & solve any problem in the app
Get step-by-step solutions on Sovi AI
Photo-based solutions with guided steps
Explore more problems and detailed explanations
B. Creating a different protein may result in neutral, beneficial, or harmful effects on the structure and function of the organism