Biologie
Biologie cellulaire, génétique, écologie et bases des sciences de la vie.
-
structure of dna: the double helix label this diagram, showing part of …
- Box pointing to dashed lines: **Hydrogen Bonds** - Box pointing to sugar-phosphate link: **Sugar-Phosphate Backbone** - Additional labels: - Blue circles: Phosphate Group - Red/…
-
1. it was a profound book that analyzed the role of envy in different t…
B. intellectual and thoughtful ### Question 2
-
multiple choice question behavior is produced by complex interactions a…
C. brain.
-
multiple choice question the ______ division of the peripheral nervous …
A. autonomic
-
hormones secreted directly by the pituitary gland control sexual urges.…
C. growth
-
name: ______ date: ______ directions: read this passage three times, on…
This appears to be a reading fluency activity where students read the passage "Reindeer" three times on different days, time themselves, count the number of words read correctly, …
-
the brain: hindbrain - hindbrain - ______________ - medulla - pons - __…
Top card: - First blank (Hindbrain structure): Cerebellum - Second blank (coordinate muscle movement): voluntary - Third blank (maintenance of): balance (or equilibrium) - Fourth …
-
1. what are two adjectives that describe the song’s mood? spirited, con…
Two adjectives describing the song’s mood are spirited and courageous. ### Question 2:
-
in 1979, bones found outside ekaterinburg, russia, were shown to be tho…
1. Correct options for why mtDNA was used: - Mitochondrial genomes are present in multiple copies in the cells. - Mitochondrial DNA does not undergo recombination. - Mitochondrial…
-
dna 1 agttactaaagcaatacatc tcaatgattttgttatgtag dna 2 aggcgggtaggcaccct…
DNA 1 because it has a lower percentage of G-C base pairs that stabilize DNA duplexes
-
question 2 (13 points) the path to industrialization began when the com…
To solve this fill - in - the - blank question about the Industrial Revolution, we analyze each blank based on historical knowledge: ### Blank 2 The first part of the passage is a…
-
question 5 of 13 during mammalian fertilization, two haploid gamete cel…
two sets of chromosomes.
-
scenario: a large lake is surrounded by land during a hot summer day. a…
C. Evaporation
-
think about it - as geneticists in the early 1900s applied mendel’s law…
### THINK ABOUT IT - As geneticists in the early 1900s applied Mendel's laws, they wondered where **genes** might be **located in the cell**. - They expected genes to be carried o…
-
the cunning swallowtail caterpillar also uses color to lie to predators…
A. This completes your training at the Animal Defense Academy. Whether you run, wear armor, stink, or lie, do your best to stay alive.
-
euchromatin both heterochromatin answer bank is found in prokaryotes ha…
## Euchromatin: - has a high level of transcription - is the major state of most genes - is loosely packed ## Both: - is a state of DNA organization ## Heterochromatin: - has a lo…
-
brain communication __________ part - neurons are separated by a space …
1. Synaptic 2. synapse 3. Neurotransmitters 4. Acetylcholine (example; Dopamine/Serotonin are also acceptable)
-
mitochondria only chloroplasts only both mitochondria and chloroplasts …
## Mitochondria only perform cellular respiration, found in animals ## Chloroplasts only perform photosynthesis, contain grana ## Both mitochondria and chloroplasts contain DNA, m…
-
select all statements that accurately describe the structures or functi…
- Mitochondria regulate apoptosis. - The synthesis of adenosine triphosphate, ATP, occurs inside the mitochondria.
-
how are pueblan milk snakes and swallowtail caterpillars different? sim…
B. The Pueblan milk snake pretends to be a different snake, while the swallowtail caterpillar pretends to be a pile of poo.
-
brain communication __________ part - neurons are separated by a space …
- First blank (space between neurons): synapse - Second blank (NT): Neurotransmitters - Third blank (example): Serotonin (or Dopamine, Acetylcholine; all are valid examples)
-
answer bank divergence of early eukaryotes occurred undigested bacteria…
- Box connected to the cell with orange organelle (after "Host cell ingested aerobic bacteria."): Undigested bacteria evolved into mitochondria. - Box connected to the cell with b…
-
fulmar birds leave their chicks alone in the nest while the parents hun…
looks
-
part 5: imagine youre there imagine it is the year 1941, and you are a …
December 1941 Dear Journal, The world feels so scary right now. Europe is at war, and just last month, Japan attacked Pearl Harbor—now America is in the war too! Everywhere, peopl…
-
i - ready if something bothers the bombardier beetle, it sprays out a b…
C. These animals make themselves taste or smell bad so that predators stay away.
-
if something bothers the bombardier beetle, it sprays out a boiling hot…
The subfield is Biology (from Natural Science discipline).
-
multiple-choice question when an atom is neutral... the electrons and p…
the electrons and protons are equal
-
poison or stink another great defense is to make yourself taste or smel…
hot
-
3. what are the two classifications of vitamins that humans need? water…
water-soluble and fat-soluble
-
2. what is another name for the category of nutrients that includes fat…
lipids
-
in part 2, chapter 5, winstons discussion with julia of jones, aaronson…
B. Winston fears that he cannot keep hold of his memories and his own private history
-
1. how do \essential\ amino acids differ from other amino acids? the hu…
The human body cannot make essential amino acids.
-
answer bank un digested bacteria evolved into mitochondria. divergence …
- Bottom left box (first step): Host cell ingested aerobic bacteria. - Box connected to the cell with mitochondria: Undigested bacteria evolved into mitochondria. - Middle right b…
-
Question was provided via image upload.
- Top blank: **Neuron** - "In the form of" blank: **electrical and chemical signals** - "An" blank: **action potential** - "1st received by a neuron's" blank: **dendrites** - "Tra…
-
rotation 1 homologous structures are those parts of an organism which h…
The frog foot and bat wing are homologous structures because they have a similar anatomical (bone) structure, indicating they evolved from a common ancestor, even though they have…
-
fill in the blanks to compare and contrast puffer fish, hedgehogs, and …
1. For the puffer fish blank: larger 2. For the hedgehog blank: curl
-
within a neuron, messages travel in a(n) ______ form. static chemical l…
D. electrical
-
brain communication - - part: - information is communicated throughout …
1. Brain Communication 2. Electrical; action potentials (or nerve impulses) 3. Chemical; neurotransmitters
-
text structures, part 1 — instruction — level d day they look like larg…
For the first blank (puffer fish's defense - related description): wetter For the second blank (pangolin's action): curl
-
6. according to greek mythology, which god or goddess stopped growing t…
B. Demeter
-
perform only three tasks ______ information from other neurons ______ i…
1. Receive information from other neurons 2. Conduct information down its length 3. Transmit information to next neuron in line
-
ready they look like large spiky balls that would be impossible to swal…
- First blank (protective parts location): outside - For the part "while ____ and pangolins ____ themselves into a ball": hedgehogs; curl (or roll, but "curl" is more accurate for…
-
1. in your own words describe what an amoeba is a single - celled eukar…
An amoeba is a single - celled eukaryotic organism. It has no fixed shape, can form pseudopodia to move and capture food (like bacteria) via phagocytosis, lives in moist/aquatic h…
-
brain anatomy - the brain is made up of - ~86 to ~100 billion nerve cel…
- ~86 to ~100 billion nerve cells (called **neurons**) and - Ten times as many **support** cells (called **glial cells**) - Physical support for **neurons** and **blood vessels** …
-
use spines or armor if you can’t run away, a nice suit of spines or arm…
A. impossible
-
nervous system - the body’s speedy, electrochemical communication syste…
- **Sensory neurons**: input to the **brain/spinal cord (central nervous system)** - **Motor neurons**: output from the brain/spinal cord to **muscles and glands** - **Interneuron…
-
florence et olivier sont deux adolescents âgés de 17 ans. ils sortent e…
a) Un être humain devient fertile à la puberté : pour une fille, entre 10 et 14 ans (début de l'ovulation) ; pour un garçon, entre 12 et 16 ans (début de la production de spermato…
-
text structures, part 1 — instruction — level d the first line of defen…
away
-
Question was provided via image upload.
1. **Autonomic** Nervous System - The part of the peripheral NS - Controls the glands and the muscles of the internal organs (i.e. heart) 2. **Sympathetic** Nervous System - Divis…
-
multiple choice question which of the following is a common excitatory …
A. Glutamate
-
the two parts of the central nervous system are the: cortex and core ar…
C. brain and spinal cord
-
build me a prokaryotic cell cell wall chloroplast cell membrane vacuole…
The components of a prokaryotic cell from the given options are: Cell Wall, Cell Membrane, Ribosomes. The other structures (Golgi Apparatus, Endoplasmic Reticulum, Centriole, Chlo…
-
problem a this table shows the radiuses of four cones with a height of …
| Radius (m) | Volume (cu. m) | |------------|----------------| | 1 | \( 6\pi\approx18.84 \) | | 2 | \( 24\pi\approx75.36 \) | | 3 | \( 54\pi\approx169.56 \) | | 4 | \( 96\pi\appr…
-
ethiopian wolves might be helping red hot poker plants reproduce by act…
1. C. pollinators 2. C. carpel 3. D. fossilized dinosaur footprints 4. C. It does not harm coral reefs. 5. C. corona 6. D. all of the above 7. C. 700 8. B. pizza boxes 9. A. Calif…
-
question 14 1 pts hemophilia is a sex - linked recessive disease. a phe…
0% ### Second Sub - Question (Parental genotypes of the woman with a hemophilic brother)
-
the spinal column protects the spinal cord and supports the head and bo…
1. vertebrae 2. toward or near the side of the body 3. cartilage
-
apply: gene expression and regulation google classroom microsoft teams …
C. pre - mRNAs are modified to include only certain exons.
-
drag each bar to the correct location on the graph. use the data provid…
- Longest green bar → 2000 (1,350 tornadoes) - Middle green bar → 2010 (1,300 tornadoes) - Shortest green bar → 1950 (200 tornadoes)
-
the following model represents the elongation stage of protein translat…
A. Arrow 1
-
red - green colorblindness is a sex - linked recessive disease. steven …
XbY ### Question 11 (Probability of colorblind son):
-
match each level to the number of living things it can support (2 point…
- First Trophic Level (Producers) : Supports the greatest number of organisms - Second Trophic Level (Primary Consumers) : Supports a smaller number of organisms - Third Trophic L…
-
what component would you need to add to the model to represent the inte…
A. Humans are the missing component that is impactful to the elephant population.
-
producer primary consumer secondary consumer tertiary consumer • has th…
- Producer: Has the largest share of total biomass - 10,000 kg - Primary Consumer: Has a much smaller share of biomass than producers - 1,000 kg - Secondary Consumer: Has less bio…
-
hemophilia is a sex - linked recessive disorder. which of the following…
XHXh (assuming the option with XHXh is one of the choices; from the visible options, the correct one is the one with XHXh, e.g., if the options are as shown, the correct option is…
-
scientists have identified the elephant as a keystone species in the af…
The populations of animals that rely on water from elephants would decrease. The ecosystem could function differently.
-
examine the elephant in the screenshot of a serengeti sage model. which…
Acacia trees increase, ants increase, and grasses and other plants decrease.
-
boys have xy sex chromosomes, and girls have xx chromosomes. true false…
True ### Question 2 (Men have a different number of autosomes than women)
-
owen finds out his credit score is 725. what does this rating say about…
C. good
-
order the steps below to show how energy flows through a food chain, be…
1. (Bottom step) Light energy is provided by the Sun. 2. Producers change light energy into chemical energy stored in food. 3. A primary consumer gets energy by eating producers. …
-
put the following levels in order, top to bottom, from the one with the…
1. Producers 2. Primary Consumers 3. Secondary Consumers 4. Tertiary Consumers
-
7 a(n) ______ makes it difficult to determine whether an experimental o…
B. confounding variable
-
select the correct answer(s) from the list(s). (1 point) producers are …
First dropdown: bottom Second dropdown: make (or produce)
-
what can we learn from comparing biomass amounts at each level? (select…
A. A large amount of energy is lost between levels E. An ecosystem can support far more producers than consumers F. The least amount of biomass is available for top meat-eaters.
-
which statements explain why biomass decreases at higher levels? (selec…
- Only a small part of energy moves between levels. - Energy is lost as heat during life functions. - Living things use energy for their own growth and life.
-
perspective in the pearl answer each question. use complete sentences. …
C. Third person (he, she, it, they) ### Question 2
-
use the ten percent rule to complete each part of the question. select …
1. The amount of energy available to primary consumers is 1,000 kg 2. The amount of energy available to secondary consumers is 100 kg 3. This pattern explains why the biomass pyra…
-
drag and drop the words into the correct locations. (2 points) only abo…
(1) 10 percent (2) heat (3) biomass
-
question (no number shown): both men and women have at least one x chro…
True ### Question 2 (Men and women are affected by sex - linked traits equally)
-
drag and drop the words into the correct locations. (2 points) in an en…
In an energy pyramid, producers are at the **lowest** level and have the **greatest** amount of energy and biomass compared to **higher** levels.
-
emit is concerned his girl is a cheater cheater pumpkin eater. their so…
No. He needs to calm down and learn science.
-
question 12 1 pts the more dominant alleles a person has, the taller th…
The genotype with the most dominant alleles is \( AaBbCCDD \) (since it has 6 dominant alleles, more than the others with 4). So the tallest person is represented by the genotype …
-
12. which of the following statements best sums up what unit 3 was abou…
D. How and why climate has been changing in connection to human activities
-
a woman who is blood type a and a man who is blood type b have a child …
The correct option is: He could be wrong if he is heterozygous for blood type B and she is heterozygous for blood type A (the third option among the given options). But if we stri…
-
the number of bacteria in a culture increases rapidly. the table below …
\(190\) ### Part (b)
-
a molecule is: a. the smallest part of a substance that is not an eleme…
A. The smallest part of a substance that is not an element
-
orange fish and yellow fish make striped babies. a yellow fish and a st…
50% Striped, 50% Yellow ### Question 8 (Tiger Tails):
-
true breeding purple and white flowers make 100% purple flowers. what t…
Classic Mendelian genetics (dominant/recessive) ### Question 5 (If black chickens and white chickens make speckled chickens...)
-
blue butterflies and red butterflies make purple butterfly babies. what…
Incomplete dominance ### Question 2 (Some traits like height or intelligence are determined by many genes)
-
atoms are composed of a. protons, neutrons, and electrons. b. positrons…
A. Protons, neutrons, and electrons.
-
(1 point) factories started manufacturing less goods the volcanic activ…
D. Humans started burning more fossil fuels since the industrial revolution (assuming the last option is labeled D; adjust the label based on the actual numbering, but the text of…
-
the law of conservation of matter states that a. matter should not be w…
B. Matter cannot be created or destroyed.
-
some processes cycle carbon into the atmosphere, some processes remove …
- Cycle carbon into the atmosphere: burning fossil fuels, respiration - Cycle carbon out of the atmosphere: photosynthesis, limestone formation, equilibrium with the ocean
-
question: 6 the chloroplasts inside a plant cell become damaged. how wi…
C. There will be a decrease in the amount of chemical energy available for the cell.
-
if you know how to think critically and have excellent problem solving …
b. thinking skills
-
if you have excellent reading, writing, and scientific literacy skills,…
d. basic skills
-
the diagram shows the nucleus and ribosomes in a cell. what is the rela…
C. Ribosomes use transcribed RNA in the nucleus to create proteins.
-
question 45 (2 points) an individual who is infected with pathogens but…
a. Carrier
-
question: 4 which statement best describes the plasma membrane of a liv…
D. designed to allow certain substances to enter and certain substances to exit the cell.
-
question 42 (2 points) besides chlorine, what are the chemical sanitize…
c. Iodine and quaternary ammonium
-
question: 3 a cell biologist compared the properties of rough endoplasm…
B. Rough ER has ribosomes on its surface.