生物
细胞生物学、遗传学、生态学与生命科学基础。
-
which of the following are associated with proteins? a peptide bonds b …
A. peptide bonds
-
figure 1. formation of a peptide bond which of the following best descr…
C. A covalent bond is formed between a carbon atom and a nitrogen atom along with the formation of $H_2O$.
-
interphase which of the following are true statements? a. dna replicate…
D. All of the above
-
which of the following is common feature of the illustrated reactions s…
C. Monomers are joined by a covalent bond, and a water molecule is produced.
-
7 mark for review which feature of model 1 best illustrates how biologi…
D. The linear sequence of the base pairs
-
read the paragraph about eadweard muybridges horse in motion photograph…
While Palo Alto used to be famous for its horse races, it is now known as a thriving center for technological research.
-
what was the main reason for the shift in the way scientists did resear…
Scientists wanted to understand the natural world through precise measurements and calculations.
-
read the paragraph about famous railway lines from around the world. se…
This rail line, which began operating in the early twentieth century, traverses much of Australia.
-
interphase which of the following is true of interphase? a. it is part …
D. Both B and C
-
directions: this short free - response question requires about 6 minute…
The primary structure of an enzyme, which is the linear sequence of amino - acids, determines its overall shape. The chemical properties of individual amino - acids in the sequenc…
-
biochemistry studies: chemical composition of materials for engineering…
Life processes like DNA and Respiration
-
as shown in the diagram, when environmental temperatures drop below fre…
C. The water molecules in ice are farther apart than those in liquid water, so the ice floats, maintaining the warmer, denser water at the lake bottom.
-
which of the following best describes how the carbohydrate polymer is b…
D. A water molecule is removed to form a covalent bond between two monomers.
-
what was one key difference between the scientific revolution and the e…
The Scientific Revolution focused on scientific discoveries, while the Enlightenment focused on social and political change.
-
directions: match the following terms with the correct descriptions bel…
1. Magnetic domain 2. Magnetic field
-
what can be concluded about the role of the catholic church in european…
The Catholic Church's influence declined as the Scientific Revolution gained prominence.
-
question 4 of 25 how is it possible that over 20 million living organis…
C. Because the bases can be arranged in many different combinations
-
thinking about how hungry you are during lecture rather than listening …
C. internal barrier
-
sparks of conflict multiple choice questions 1. what was one major caus…
1. A. Competition for control of the fur trade 2. B. In the Ohio River Valley 3. C. The Seven Years' War 4. D. By intensifying competition between France and Great Britain 5. C. T…
-
29 multiple choice 1 point according to will smith in one strange rock:…
C. The Sun
-
review the vocabulary and concepts 1. the phase of the cell cycle which…
1. Mitosis 2. cell cycle 3. Cytokinesis 4. Kinetochore 5. Prophase, Nucleolus 6. centromere 7. Equatorial plate, Metaphase 8. Anaphase 9. Nuclear membranes 10. centrosome 11. chro…
-
what is one way the scientific revolution changed how scientists viewed…
B. Scientists started to use observation and experimentation to understand nature.
-
stuart is studying weather data for his region. the data was gathered f…
A. Average annual rainfall for 1985 - 2016 increased by 20 percent compared to the previous 30 years.
-
biologyliving earth a term af - period 1 - rm 359 (lms) quiz: climate, …
B. an increase in average temperatures on Earth’s surface
-
24 multiple choice 1 point what is the process where plants release wat…
A. Transpiration
-
homer notices that his shower is covered in a strange green slime. his …
6. Homer's shower is covered in a strange green slime. 7. The half of the shower sprayed with water. 8. The substance sprayed (coconut juice or water). 9. The appearance of the gr…
-
name: emmanuel orviz vocabulary quiz, pages 37 - 40 i. directions: read…
1. Verdadero 2. Verdadero 3. Verdadero 4. Falso 5. Verdadero 6. Verdadero 7. Falso 8. Verdadero 9. Verdadero 10. Verdadero 11. Verdadero 12. Falso 13. Verdadero 14. Verdadero 15. …
-
11:16 5g 56 take quiz exit steal away home. (havent got long) i havent …
C. Midnight hour and home; referring to the time to escape to the North.
-
question 1 lets practice your budgeting knowledge. below is a list of s…
Fixed Expense: mortgage payment, cable bill Variable Expense: fast food, cell phone bill, water bill Unexpected Expense/Emergency Fund: washing machine repair bill
-
read the excerpt from the time - travellers guide to elizabethan englan…
Large towns are less vulnerable, being part of an international market that sees preserved foods traded long - distance; but much of the countryside is dependent on fresh food.
-
9 matching 6 points match the term on the left w lipid nucleic acid mac…
Lipid - Fats, oils, and waxes; used for long - term energy storage and cell membranes Nucleic Acid - Stores and transmits genetic information (DNA and RNA) Macromolecule - Large o…
-
(5 of 7) how could you tell that the solution you chose was the most hy…
The potato cells lost the most mass in that solution.
-
states as shall have been abandoned, or to which the united states shal…
This law was designed to improve the lives of former slaves.
-
(4 of 7) based on the average % change values that you calculated which…
B. 0.6 Molar Sucrose
-
biology/living earth a: term af - period 1 - rm 350 (lms) practice quiz…
C. Changes to Earth’s orbital path occur in a cycle that repeats every 100,000 years.
-
(3 of 7) how could you tell that the solution you chose was the most hy…
The potato cells gained the most mass in that solution.
-
look up (and write down) a definition for each of the following: pulque…
Pulque: A fermented beverage made from the sap of certain agave plants, traditionally consumed in Mexico. Bougainvillea: A genus of thorny ornamental vines, bushes, and trees with…
-
(2 of 7) based on the average % change values that you calculated which…
O 0 Molar Sucrose
-
clash of empires multiple choice questions 1. who were the primary part…
1. B. France, Great Britain, and Native American tribes 2. C. Dominating the fur trade in North America 3. D. Iroquois Confederacy 4. A. The Seven Years' War 5. C. To maintain aut…
-
michael has tested 4 different solutions of variable glucose concentrat…
A. The solution added to Tube C did not contain simple sugar. C. Tube C was not heated for the correct amount of time.
-
use the sentence to answer the question. the softball tournament was or…
I organized the softball tournament with the help of my teammates.
-
quiz: the tell - tale heart locked mode is on. to avoid losing your pro…
C. His eye - like a vulture
-
lynn performed the benedict test on water (tube a) and three samples of…
Tube A was contaminated by the contents of one of the other tubes.
-
9 connect to science choose true or false. (4 x 1 pt. each = 4 pts.) ex…
1. a. true 2. b. false 3. b. false 4. a. true
-
the articles of confederation to the concern it was meant to address. t…
1. Concern: The majority of colonial leaders did not want a single national leader with power like a king. Feature of the Articles: The Articles of Confederation had no president,…
-
glucose and starch are both carbohydrates. why does glucose produce a n…
C. Iodine only tests for polysaccharides, and glucose is a monosaccharide
-
most states had serious economic problems under the articles of confede…
Cause 1: Congress did not have the power to raise taxes, so it could not afford to pay the army. Effect 1: Some former soldiers like Daniel Shays were angry that they were not pai…
-
what does the decline of the songhai empire reveal about the challenges…
B. Internal political divisions made empires vulnerable to external threats
-
what is the purpose of testing distilled water in tube 3? to eliminate …
To eliminate the possibility that the water portion of the potato and onion solutions causes a positive result.
-
how did askia muhammad is administrative reforms contribute to the song…
He created a balance between central authority and local autonomy
-
isle royale national park in michigan has a problem. in 2009, twenty - …
C. decreasing
-
which solution is the positive control? distilled water starch solution…
C. Glucose solution
-
role in soil formation, water purification, air purification, nutrient …
living and nonliving entities in a specific area
-
description: large areas of forest are cleared for agriculture, logging…
- ¿Cuál es la esfera que es impactada primero? La biósfera. - ¿Cómo cambia la deforestación la atmósfera y el hidrosfera? En la atmósfera, reduce la absorción de dióxido de carbon…
-
match the writings with each of the philosophers. john locke thomas hob…
John Locke - Two Treatises of Government Thomas Hobbes - Leviathon Jean Jacque Rousseau - No book title, just journals (this is an incorrect match as he has well - known books but…
-
introduction to enzymes lab background information: enzymes are protein…
1. Optimal; 98.6; 37; denature 2. Neutral; 7; stomach
-
positive feedback loops can drive a system to extremes, while negative …
Negative
-
quiz question 1 of 8 alida works from home. which item is a want for he…
D. Streaming service
-
3. what happened to the number of cells when you changed the persons he…
Typically, a taller person has more cells than a shorter person due to the need to build and maintain a larger body structure, but other factors can influence this relationship.
-
which of these sentences uses quotation marks and other punctuation cor…
"Can I get a new cell phone?" wondered Petra, "while I still have three months left on my old contract?"
-
of corn, every head of wheat sown by sweat and hands, hands gleaning co…
It represents the different types of purposeful labor people do on the land.
-
1. a. click on enter or edit dna and copy this code: atgccagggcggagagct…
1. First, change the 4th base of the DNA sequence ATGGCAGGGCGGAGAGCTAA to G, getting ATGGCGGGGCGGAGAGCTAA. 2. Then, proceed through the steps of transcription and translation usin…
-
2. what did you notice about the rate of cell division in the different…
Different cell types have different rates of cell division, influenced by factors such as function, location, and tissue needs.
-
unicellular organisms can be prokaryotic or eukaryotic, but all complex…
A cell lives in a boiling hot spring. It uses chemicals like sulfur for energy instead of sunlight or food. Its DNA floats freely inside of its cytoplasm: Prokaryotic A cell lives…
-
a prokaryotic cell and a eukaryotic cell are shown. which characteristi…
The organization of the genetic material
-
historically, the product - life - cycle theory is an: a. accurate expl…
B. accurate explanation of international trade patterns in some countries but not in others
-
historically, the product - life - cycle theory is an: a. accurate expl…
B. accurate explanation of international trade patterns in some countries but not in others
-
name the 3 scientists that played a major role in the development of ce…
Matthias Schleiden, Theodor Schwann, Rudolf Virchow
-
which result is most likely if enzymes are exposed to very high tempera…
First question: Enzymes will denature and be unable to function. Second question: Enzymes lower the activation energy of a chemical reaction.
-
which of the following biomolecules is primarily used by the body for l…
1. Lipids 2. It is a type of protein that speeds up chemical reactions
-
this is a system of measurement that is also called si units * internat…
International System of units
-
1. how did the different cell types in the simulation come to be?
They likely came to be through programming based on biological models of cell - differentiation processes such as gene expression, signaling pathways, and environmental cues that …
-
match the following biomolecules with their function. lipids choose car…
Lipids: Fats and oils that store energy and help form cell membranes. Carbohydrates: Sugars and starches that provide quick energy for cells. Nucleic Acids: (No full - correct opt…
-
select the tubes that contain protein. select all that apply. tube 1: p…
Tube 1: Pepsin, Tube 2: Albumin
-
identify the stages of mitosis review the stages of mitosis metaphase a…
From top to bottom: Telophase, Anaphase, Prophase, Metaphase, Prometaphase
-
read the section on prokaryotes and eukaryotes to identify the similari…
| Cell type | Cell size | Nucleus | Complexity | Example of organism with this cell type | |--|--|--|--|--| | Prokaryotic Cell | smaller | no | less complex | Bacteria | | Eukaryo…
-
a group of scientists introduced 64 birds into a wildlife sanctuary and…
729
-
multiple - choice question cancer is essentially just cell death sick c…
Uncontrolled Cell Growth
-
this is a system of measurement that is also called si units * your ans…
International System of Units
-
which solution is the negative control? distilled water albumin pepsin …
Distilled water
-
what happens in cytokinesis? the cell prepares to split again. the cell…
The cells splits into two.
-
in telophase... the chromosomes condense two new nuclei form with 46 ch…
two new nuclei form with 46 chromosomes each
-
in anaphase... two new nuclei form chromosomes split apart chromosomes …
chromosomes split apart
-
in metaphase... chromosomes split apart chromosomes condense chromosome…
chromosomes line up in the middle
-
6173 - 3: 2025 - sep - 10wk - mm: international business manager wk - m…
True
-
in prophase.... chromosomes line up in the middle chromosomes split apa…
chromosomes condense
-
173 - 3: 2025 - sep - 10wk - mm: international business ma - mm time le…
A. voluntary export restraint
-
what occurs during anaphase? the cell divides into two new cells. centr…
Chromosomes are pulled to opposite sides of the cell.
-
mm6173 - 3: 2025 - sep - 10wk - mm: international business 10wk - mm qu…
C. To protect domestic producers from "unfair" foreign competition
-
root words karyo comes from the greek karyon, meaning ut\ or \kernel.\ …
A membrane - bound nucleus.
-
reading tool compare and contrast transmission and scanning electron mi…
TEM images are 2 - D cross - sections of thin samples, while SEM images are 3 - D surface - detailed images.
-
question 13 (08.01 mc) a biologist created the following graph to show …
The number of larvae is greatest at 5 degrees Celsius.
-
what occurs during metaphase? the chromosomes line up in the middle of …
The chromosomes line up in the middle of the cell.
-
prokaryotes and eukaryotes q. key question how do prokaryotic and eukar…
| | Prokaryotic Cell | Eukaryotic Cell | |--|--|--| | Cell membrane | yes | yes | | Nucleus | no | yes | | Cell size | smaller | larger | | Complexity | simpler | more complex | |…
-
which of the following occur during prophase? check all that apply. nuc…
Nucleus is present.
-
1. reading check how did observations of the natural world bring change…
Observations of the natural world in Italy led to more realistic and detailed art, with artists studying nature to improve techniques like anatomy, perspective, and light - shadow…
-
true or false? a chromosome and chromatid are the same thing. false tru…
False
-
mm6173 - 3: 2025 - sep - 10wk - mm: international business manag 0wk - …
A. Smoot - Hawley Act
-
why should we duplicate the chromosomes before mitosis? so each new dau…
So each new daughter cell has the exact number of chromosomes as the parent cell
-
read this portion of an outline from a passage. 1. organic produce a. o…
point - by - point comparison