Question

convert the dna into a mrna and then decode the mrna into a sequence of amino acids. then convert the sequence into a single letter code. problem 1 3 atgagtactaagactttattaggccgggactc c 5 value: 10 what is the single letter code for the protein produced from the dna in problem 1?

Explanation:

Step1: Transcribe DNA to mRNA

DNA: 3' ATGAGTACTAAGACTTTATTAGGCCGGGACTCC 5'
mRNA is synthesized in the 5' - 3' direction complementary to the DNA template strand. So, the mRNA sequence is 5' UACUCAUGAUUCUGAAAUAAUCCGGCCCUUGAGG 3'

Step2: Divide mRNA into codons

The mRNA sequence is divided into groups of three nucleotides (codons). The codons are UAC UCA UGA UUC UGA AAU AAU CCG GCC CUU GAG G

Step3: Decode codons to amino - acids

Using the genetic code table:

• UAC codes for Tyrosine (Y)
• UCA codes for Serine (S)
• UGA is a stop codon, so translation stops here.

Answer:

Y - S