Question

5 an illustration of how a particular dna mutation will most likely affect the polypeptide produced is shown. original dna strand 3 gtagtagtagtagtagtagta 5 his his his his his his his mutated dna strand 3 gtagtagtaggagtagtagta 5 his his his pro his his his what type of mutation is illustrated? a insertion b translocation c substitution d deletion

Explanation:

Compare the original and mutated DNA strands. One nucleotide has been changed (T to G), resulting in a different amino - acid (His to Pro). Substitution mutation is when one base is replaced by another. Insertion adds bases, translocation moves segments to other locations, and deletion removes bases. Here, only one base is replaced.

Answer:

C. Substitution