Question

1. lion geography, genetics, and phylogeny
2. why are some dna sequences different from others?
3. what does this mean in terms of prides relatedness?
4. which two populations share the most genetic information? how do you know?
5. based on the data, a lion from the fannie roberts pride most likely interacted with which pride?
6. how is a gene different than dna?

look at the colored dna
cameroon ttctccattcttctaatcctaatacccatctcaggcattattgaaaaccgcctcctcaaat
tsavo ttctccattcttctaatcctaatacccatctcaggcattattgaaaatcgcctcctcaaat
fannie roberts ttctccattcttctaatcctaatacccatctcaggcattattgaaaaccgcctcctgaaat
sabi sands ttctccactcttctaatcctaatacccatctcaggcattatcgaaaaccgcctcctcaat
umfolozi ttctccattcttctaatcctaatacccatctcaggcattatcgaaaaccgcctcctcaat
zimbabwe ttctccattcttctaatcctaatacccatctcaggcattatcgaaaaccgcctcctcaat
zambia ttctccattcttctaatcctaatacccatctcaggcattatcgaaaaccgcctcctcaat
kalahari ttctccattcttctaatcctaatacccatctcaggcattattgaaaaccgcctcctcaat
botswana ttctccactcttctaatcctaatacccatctcaggcattattgaaaaccgcctcctcaat
etosha ttctccactcttctaatcctaatacccatctcaggcattattgaaaaccgcctcctcaat

sequences provided. answer:
which prides are most related?
what conclusions can we draw about dna differences and pride location?

Explanation:

Step1: Mutations and evolution

DNA sequences differ due to mutations (changes in DNA - base pairs), genetic recombination during reproduction, and evolutionary divergence over time.

Step2: Genetic relatedness and DNA

More similar DNA sequences between prides mean closer relatedness. It implies a more recent common ancestor and less genetic divergence.

Step3: Comparing DNA sequences

To find which two populations share the most genetic information, compare the DNA sequences base - by - base. The ones with the fewest differences are most related. Without specific similarity metrics, visually compare the sequences provided.

Step4: Interaction and relatedness

A lion from Fannie Roberts pride is most likely to have interacted with a pride that is genetically similar, as genetic exchange is more likely between related groups. Compare its sequence to others.

Step5: Gene and DNA definition

DNA is a long polymer of nucleotides. A gene is a specific segment of DNA that contains the instructions for making a functional product (usually a protein or RNA molecule).

Step6: Most related prides

Visually compare the provided DNA sequences of the prides. The prides with the most similar sequences are most related.

Step7: DNA differences and pride location

If prides that are geographically closer have more similar DNA, it may suggest limited gene - flow between distant prides due to geographical barriers. If there is no correlation, other factors like historical migrations may be at play.

Answer:

1. Due to mutations, genetic recombination, and evolution.
2. More similar DNA means closer relatedness and a more recent common ancestor.
3. Compare the DNA sequences base - by - base to determine; visually inspect the provided sequences for similarity.
4. The pride with the most genetically similar DNA sequence to Fannie Roberts pride.
5. DNA is a long - chain nucleotide polymer; a gene is a functional segment of DNA.
6. The prides with the most similar DNA sequences (requires visual comparison of provided sequences).
7. If geographically close prides have similar DNA, geographical barriers may limit gene - flow; if not, other factors like migrations are involved.