Question

part iii: prince william sound gttcacagt tgagct gtggtattttacgcatagact tacatatccgccta cook inlet gttcacagt tgaoct gtggtattttacgcatagact tacatatccgccta kenai peninsula gctccacagt tgagct gtggtattttacgcacagact tocatatccgccta gulf of alaska gttcacagt tgagccgtggtattttacacatagact tacatatccgccta seward gctccacagt tgagct gtggtattttacgcacagact tocatatccgccta homer gctccacagt tgagct gtggtattttacgcatagact tocatatccgccta 5. which of the following questions can be answered using the information provided above? circle the correct answer. a. how many otters live in a family? b. which otter family needs to consume the most energy? c. where do otter families live? d. which otter families are most closely related to each other? 6. explain how you would use this specific data to answer this question. you can answer the question \which otter families are most closely related to each other?\ using the data above by comparing each families pattern(genes). when you compare them you can find out which are closely related and which arent. 7 a. identify at least one family that is closely related to the otters of the seward family. 7 b. based on only the data above, what can you assume about the geographic location of these families? explain why.

Explanation:

For question 5, the data provided consists of genetic - like sequences for different otter families. By comparing these sequences, we can determine genetic relatedness. There is no information about the number of otters in a family, energy consumption, or exact locations. So we can answer which otter families are most closely related.
For question 6, comparing the genetic - like sequences helps in determining relatedness as more similar sequences indicate closer relationships.
For question 7a, we need to compare the Seward family's sequence with others to find a closely related one.
For question 7b, since the data only gives genetic - like sequences and names of locations, we can't accurately determine geographic locations. But we can assume that families with more similar sequences might be geographically closer as gene flow is often higher between nearby populations.

Answer:

1. d. Which otter families are most closely related to each other?

7 a. (Answer depends on actual comparison of sequences. For example, if Cook Inlet's sequence is very similar to Seward's, it could be Cook Inlet).
7 b. We can assume that otter families with more similar genetic - like sequences might be geographically closer together because gene flow is typically higher between nearby populations, but the data provided is not sufficient for precise geographic location determination.