Biología
Biología celular, genética, ecología y fundamentos de ciencias de la vida.
-
carbohydrates nucleic acids lipids proteins which macromolecule is stru…
Nucleic acids
-
question 3 the membranous organelle that contains the majority of the d…
A. Nucleus ### Question 4
-
why are unsaturated fats typically liquid at room temperature? they hav…
The correct option is the orange one: "Their double bonds create kinks, preventing tight packing."
-
question 1 8 points the membranous organelle that functions to convert …
C. Mitochondria ### Question 2
-
which of the following best describes the structure of a triglyceride? …
One glycerol and three fatty acids (the option with this text, likely the purple - colored option in the image)
-
passage 1 this brief essay by author and college professor charles augu…
He conveys that many different arguments can be presented against socialism.
-
where can helpful bacteria be found? (there may be more than one answer…
- Yogurt - Digestive tract - Skin
-
directions bacteria grow at different rates depending on the temperatur…
- First Container (72 hours): 4 bacteria - Second Container (72 hours): 4096 bacteria (And the tables are filled as shown above.)
-
which theory of government claims that the king connects the heavens an…
A. divine right theory
-
which atom is not typically present in most lipids? carbon hydrogen nit…
Nitrogen (the option with "Nitrogen" text, typically the orange - colored card in the given options)
-
use the graph below to answer the following question: approximate popul…
A. During this period, an increase in scientific and medical discoveries improved life expectancies across Europe.
-
which theory is most closely associated with john locke? ○ social contr…
A. social contract theory
-
which term relates to the theory that states that governments developed…
A. evolution theory
-
a food label lists \partially hydrogenated oils.\ what does this indica…
The oil contains trans fats. (The option with this statement, likely the cyan - colored one in the image)
-
if a lipid contains more carbon-hydrogen bonds, what can you infer abou…
It has more energy.
-
what are lipids? complex carbohydrates like starch; polymers made of am…
Fatty acids not generally soluble in water
-
12. circle the letter of each statement that expresses a scientific law…
c. If all other variables are kept constant, the volume of a gas increases as the temperature increases. ### Question 13
-
6. based on the diagram above, what do you think is the role of an inhi…
The role of an inhibitor is to bind to the enzyme (at its active site) and prevent the substrate from binding to the enzyme, thus inhibiting the enzyme - catalyzed reaction. ### Q…
-
what is the monomer unit of lipids? nucleotide fatty acid amino acid mo…
Fatty acid
-
______ is a relationship in which both members ______; ______ is a rela…
First sentence: Mutualism; benefit Second sentence: Commensalism; benefits; neutral (Note: The word bank terms are used as follows: - Mutualism (relationship, both benefit) - Comm…
-
la (ameoba sisters) la (updated) sisters multiple-choice question true …
False (the option to select is the checkbox next to "False")
-
when writing about environment concerns, which topic would demonstrate …
C. a discussion of international agreements involving environmental protection
-
which theories hold that many ordinary people have access to power? ○ e…
B. pluralist
-
which sentence is an example of how a scientist might use a model? ○ a …
B. Marbles placed inside a hollow sphere are used to describe protons in a nucleus.
-
5 multiple choice 4 points what is the minimum amount of protein (in gr…
B. 59 grams ### Question 6
-
which explanation accurately describes one way in which pairs of organe…
B. Lysosomes contain enzymes that can digest the contents of vacuoles.
-
which of the following is a function of lipids in living organisms? sto…
Long - term energy storage (the option with the orange background: "Long - term energy storage")
-
this time there was no murmur in the air, no warning of approaching dan…
A. to show the contrast between the peaceful silence and the devastation
-
slide 7: realistic outcomes consider what success might actually look l…
A successful revolution could overthrow an oppressive regime, establish a just social/political system, redistribute resources fairly, gain self - determination, and implement ben…
-
12. circle the letter of each statement that expresses a scientific law…
c. If all other variables are kept constant, the volume of a gas increases as the temperature increases. ### Question 13
-
structure\tplants\tanimals\tfungi cell wall\t✔️\t\t✔️ large central vac…
A. Plants do not have a skeletal system, therefore the large central vacuole provides extra support to plant cells.
-
most power in the world today is held by what type of governments? ○ na…
A. national
-
lysosomal storage diseases are a group of inherited diseases each cause…
B. Certain macromolecules accumulate to toxic levels within the cell.
-
a student is given a list of molecules: glucose, cholesterol, starch, a…
Cholesterol, because it is a lipid molecule.
-
for the dna sequence below, complete the complementary missing dna stra…
Complementary DNA strand (5'→3'): 5' ATCCCTAAGTCCGATCATGCTAACATT 3' (Wait, no, earlier mistake: when original is 5'→3', complementary DNA is 3'→5' as A T C C C T A A G T C C G A T…
-
which term is defined as when a state has the power to determine its fo…
sovereignty (the option with "sovereignty" as the text)
-
plant cells and bacterial cells both have cell walls, but the compositi…
A. Plant cell walls are made of cellulose, while bacterial cell walls are made of peptidoglycan.
-
which statement is an example of effective digital leadership? the lead…
The leader reports to her boss that a member of her group used an expensive illustration from the Internet without paying for it.
-
tissues exam review 1. what are the 4 broad categories of tissues? what…
- Epithelial: Protection, secretion, absorption, filtration. - Connective: Support, binding, protection, transport. - Muscular: Movement. - Nervous: Signal transmission (communica…
-
prokaryotic organisms are the simplest types of cells and often lack ce…
D. They lack endoplasmic reticulum and Golgi apparatus and therefore cannot perform basic functions such as protein synthesis and transport.
-
which of the following is not a function of lipids? enzyme catalysis ce…
Enzyme catalysis
-
multiple choice choose the one alternative that best completes the stat…
c. confirm the power switch is set to OFF ### Question 2
-
fill in the blank with the correct response symbiosis is a close, long …
1. between 2. Parasitism 3. Mutualism 4. Commensalism 5. benefits
-
there is a group of disorders related to a particular organelle that ca…
D. The mitochondrion could be responsible because of its role in the manufacturing of ATP.
-
which of the following organelles directs cellular activity and stores …
C. nucleus
-
match the following substances with their categories. maltose carbohydr…
- Maltose - Carbohydrate - Steroid - Lipid - Phospholipid - Lipid - Sucrose - Carbohydrate
-
based on the myths the maori: genealogies and origins in new zealand an…
has a strong sense of community.
-
part b which excerpt from the passage best supports the correct answer …
3. "New York newspapers declared that those who bought British goods were 'enemies to their Country.' In Philadelphia, newspapers preferred the phrase 'an Enemy to the Liberties o…
-
which organelles work together to transform the energy of organic compo…
A. mitochondria and chloroplast
-
is the following statement a good definition? a cat is an animal that i…
no
-
if a cell needs to store energy for a long period, which macromolecule …
Lipids, because they store more energy per gram.
-
dylan’s nobel prize settles debate: rock lyrics are poetry by: dan delu…
Overall, DeLuca’s wide - ranging evidence will prove that rock lyrics are indeed poetry.
-
which of the following is a type of lipid found in cell membranes? 6/25…
Phospholipid (the option with "Phospholipid" text, likely the blue - colored option among the choices)
-
¿cuál es el tema central del artículo? * los avances científicos del si…
La explotación de minorías en la experimentación médica
-
function includes insulation and energy storage bone adipose fibrocarti…
Adipose
-
read the excerpt from parvati’s argument in favor of using cell phones …
It is relevant and sufficient, because she gives convincing examples of how phones support classwork.
-
2. i’m strong and stiff getting through me is tough i’m found only in p…
Lignin (or Cell Wall, but more likely Lignin for the "makes sticks tough" part as lignin provides rigidity to plant stems)
-
part b select two sentences from the passage that best help develop the…
1. "Lawyers, whose documents were also taxed, were harmed by the Stamp Act as well, and together, newspaper publishers and lawyers led a successful campaign to repeal the act." (P…
-
chapter 3 review 1. list the 3 main parts of the cell. 2. ribosomes, mi…
The three main parts of the cell are the cell membrane (plasma membrane), the cytoplasm, and the nucleus. ### Question 2
-
what is the polymer form of lipids called? nucleic acid triglyceride po…
Triglyceride
-
26 guided practice activities — vocabulary flash cards 1a capítulo 1a v…
This appears to be a vocabulary flashcard activity where you need to describe or write the action/activity shown in each illustration. Let's go through each cell (assuming it's a …
-
exit ticket 1.9 – neolithic revolution: seminar to what extent did the …
The Neolithic Revolution brought significant progress in establishing agriculture, social organization, and technological innovation, yet it also introduced challenges like social…
-
what does the myth attempt to explain? select four options. □ why the m…
- why the Maasai herd cattle - why there is rain and drought - how the Maasai interact with nature - what the relationship is between supernatural beings and humans
-
which of the following is an example of a lipid? triglyceride cellulose…
Triglyceride
-
3 look at this food web. then answer the questions. a name two producer…
land plants, tiny water plants ### Part b
-
what was the first great awakening? a political revolution in the colon…
A movement of religious revival during the mid to late 18th century
-
a scientist finds a molecule made of carbon, hydrogen, and oxygen, with…
Lipid
-
what is the monomer of carbohydrates? type your answer in the boxes
Monosaccharide
-
answer the following question: cer: what might be the benefit of an org…
- **Claim**: A benefit of an organism being multicellular is having specialized cells to perform distinct functions for more complex and efficient life processes. - **Evidence**: …
-
a ______ is a large molecule. options: polymer, macromolecule, micromol…
B. Macromolecule
-
which of the following is not one of the four major classes of macromol…
B. Carbon
-
multiple-choice question what do all life on earth share? a common gene…
A. A common genetic code, C. A common ancestor
-
11. describe the difference between pulmonary circulation and coronary …
- **Pulmonary Circulation**: Circulates blood between heart and lungs. Deoxygenated blood from right ventricle goes to lungs (via pulmonary artery) for gas exchange (loses CO₂, ga…
-
name: ______________ class: ______________ date: ______________ match e…
s for Matching (1 - 10) 1. e 2. g 3. b 4. j 5. c 6. d 7. a 8. f 9. i 10. h
-
be sure to place your phone in the cell phone lock box every day. inter…
preposition
-
what was the enlightenment? a religious revival movement a time period …
B. A time period about obtaining the freedom to exercise your own intelligence (assuming the blue option is labeled B; if labels were A - D with blue as B, this is the correct cho…
-
which statement is false regarding the redox reactions shown? a. it req…
D. None are false; all are true statements.
-
stealing the day by samantha g. (excerpt) i achieved the unofficial \sm…
has something to lose
-
1. **how are the blue whale and adelie penguin alike as consumers? 2. *…
Both the blue whale and Adelie penguin are consumers that feed on krill. They are heterotrophs (rely on consuming other organisms for energy) and not primary producers, with krill…
-
is the following statement a biconditional? if alice is playing a violi…
no
-
hbs a – keep in science notebook 7. on your organizer, use a system of …
To solve the problem of writing sentences for the remaining directional terms (Ventral and Dorsal) using human anatomy structures, we can follow these steps: ### Step 1: Recall th…
-
question 9 macronutrients are. a nutrients that are large in terms of m…
C. nutrients our body needs in large amounts.
-
how are the blue whale and adelie penguin alike as consumers?
Both the blue whale and Adelie penguin are heterotrophic consumers (they don't produce their own food) and rely on consuming other organisms (e.g., krill, small marine life) for e…
-
question 8 the primary material for our cell membranes comes from. a pr…
E. fats.
-
question 7 vitamins are an important dietary ingredient because most ar…
B. coenzymes.
-
question 6 enzymes speed up chemical reactions by ___ the energy needed…
B. decreasing
-
what was the catholic church’s response to the protestant reformation c…
B. The Counter - Reformation ### Second Question:
-
study guide: chapters 8 and 9 energy, photosynthesis and cellular respi…
Autotrophs ### Question 2:
-
question 5 what is the complex carbohydrate used for energy storage in …
C. glycogen
-
question 4 when food is being digested and broken down into its constit…
B. amino acids from proteins
-
question 3 what is the complex carbohydrate used for energy storage in …
B. starch
-
be sure to place your phone in the cell phone lock box every day. prono…
preposition (the red box labeled "preposition" is the correct category for the word "IN")
-
could a bacterium obtain energy from succinate as an electron donor and…
A. Yes
-
2. which structure makes up the major component of cell membranes? a. s…
B. Phospholipids ### Question 3:
-
question 2 10 points would a mutation in an enzyme that changes the sha…
E. Yes, because the substrate has to fit specifically into the active site to undergo the reaction.
-
3. (sourcing, contextualization) why might this report be a good source…
The report might be a good source if it was created by a credible author (e.g., a government inspector, a journalist with direct access to the plants) who had the ability to obser…
-
what are the 3 parts of the cell theory? definition\tpicture to help yo…
s 1. All living organisms are composed of one or more cells. 2. The cell is the basic unit of structure and function in living organisms. 3. All cells arise from pre - existing ce…
-
ancient chinese civilization began in ______ china. options: southern, …
B. northern ### Question 2 (Much of what is known about the legendary ____ dynasty has been passed down through oral tradition and myths)
-
exam : alzheimer’s disease and related disorders: adls and behaviors 6.…
C. Providing easy - to - remove clothing ### Question 7
-
post-assessment question 1 of 8 which type of conflict is a struggle wi…
A. Internal Conflict (assuming the first option is labeled as such, as per the selection in the image)