Sovi.AI - AI Math Tutor

Scan to solve math questions

QUESTION IMAGE

| organism | biochemical data | | --- | --- | | amoeba | amino acid seq…

Question

organismbiochemical data

| amoeba | amino acid sequence: iso - ser - asp - gln - phe - ile - lue - gln - ser - arg - leu - leu - his
dna sequence: attagcgaccagtttatccacaatcccgtctacttcat |
| kangaroo | amino acid sequence: leu - iso - pro - pro - phe - ile - leu - leu - ser - his - leu - leu - ser
dna sequence: ctaatccccccgtttatcctatttcccatctactaagt |
| earthworm | amino acid sequence: leu - iso - asp - pro - phe - ile - leu - his - ser - arg - leu - leu - arg
dna sequence: cttatcgacccgtttatcctacattcccgtctaccttcgt |
| cat | amino acid sequence: leu - iso - pro - pro - phe - ile - leu - leu - ser - his - leu - leu - ser
dna sequence: ttaatccccccgtttatcctatttcccatctactaagt
based on the information above, which two organisms are most closely related?
select one:
○ a. cat and kangaroo
○ b. amoeba and earthworm
○ c. kangaroo and amoeba
earthworm and cat

Explanation:

Brief Explanations

To determine relatedness, compare amino acid/DNA sequences. More identical sequences mean closer relation. Kangaroo and cat have nearly identical amino acid sequences (only a single position difference: Kangaroo ends with SER, Cat ends with SER; their core sequences match almost perfectly, unlike other pairs which have more differences). Their DNA sequences also share high similarity.

Answer:

a. Cat and kangaroo