Question

dna 1
agttactaaagcaatacatc
tcaatgattttgttatgtag

dna 2
aggcgggtaggcaccctta
tccgcccatccgtgggaaat

which of the two molecules of dna has the lower melting temperature? why?
○ dna 2 because dna 1 may form more secondary structures
○ dna 2 because it has 19 base pairs, whereas dna 1 has 20 base pairs
○ dna 1 because dna 2 may form more secondary structures
○ dna 2 because it has a lower percentage of a-t base pairs that stabilize dna duplexes
○ dna 1 because it has a lower percentage of g-c base pairs that stabilize dna duplexes

Explanation:

DNA melting temperature depends on the proportion of G-C base pairs, as G-C pairs form 3 hydrogen bonds (stronger than the 2 in A-T pairs), increasing stability and melting temperature.

1. Count G-C pairs in DNA 1:

• Strand 1: A G T T A C T A A G C A A T A C A T C → G, C, G, C, C → 5 G/C; Strand 2: T C A A T G A T T C G T T A T G T A G → C, G, C, G, G → 5 G/C. Total G-C pairs: 5.
• Total base pairs: 20. G-C percentage: $\frac{5}{20} = 25\%$

1. Count G-C pairs in DNA 2:

• Strand 1: A G G C G G G T A G G C A C C C T T A → G, G, C, G, G, G, G, G, C, C, C → 11 G/C; Strand 2: T C C G C C C A T C C G T G G G A A T → C, C, G, C, C, C, C, C, G, G, G → 11 G/C. Total G-C pairs: 11.
• Total base pairs: 19. G-C percentage: $\frac{11}{19} \approx 57.9\%$

DNA 1 has a lower percentage of stabilizing G-C base pairs, so it has a lower melting temperature.

Answer:

DNA 1 because it has a lower percentage of G-C base pairs that stabilize DNA duplexes