period: 5 date: 9-5-2025
dna review quiz
1. what is the structure of dna called?
2. what are the four base pairs of dna?
3. draw a 20 letter dna template strand and the complementary strand.
4. what is the function of dna polymerase?
5. what are the 3 building blocks of dna?
6. the ______________ is the structure that contains all three building blocks of dna?
7. dna located in the ______________ of a human cell.
8. dna located in the ______________ of a bacteria cell.
9. dna located in the ______________ of a virus.
10. dna has a ______________ charge.
11. a section of dna that codes for a protein is called a ______________.

Question

Accepted Answer

### Question 1
# Brief Explanations:
The structure of DNA is known as a double - helix. This was discovered by Watson and Crick, and it consists of two strands of nucleotides that wind around each other in a spiral shape, held together by hydrogen bonds between complementary base pairs.
# Answer:
The structure of DNA is called a double - helix.

### Question 2
# Brief Explanations:
The four base pairs in DNA are adenine (A), thymine (T), cytosine (C), and guanine (G). Adenine pairs with thymine, and cytosine pairs with guanine, following the base - pairing rules that are fundamental to the structure and function of DNA.
# Answer:
The four base pairs of DNA are adenine (A), thymine (T), cytosine (C), and guanine (G).

### Question 3
# Brief Explanations:
1. First, we choose a 20 - letter DNA template strand. Let's use a random sequence of the four bases (A, T, C, G). For example, the template strand could be: ATGCTAGCTAGCTAGCTAGC
2. Then, to find the complementary strand, we use the base - pairing rules: A pairs with T, T pairs with A, C pairs with G, and G pairs with C. So the complementary strand for the above template would be: TACGATCGATCGATCGATCG
# Answer:
Template strand: ATGCTAGCTAGCTAGCTAGC
Complementary strand: TACGATCGATCGATCGATCG

### Question 4
# Brief Explanations:
DNA polymerase has a key function in DNA replication. It is responsible for adding nucleotides to the growing DNA strand. It can only add nucleotides in the 5' to 3' direction and also has a proofreading function to correct errors during replication.
# Answer:
The function of DNA polymerase is to synthesize new DNA strands by adding nucleotides to a pre - existing DNA template during DNA replication, and it also proofreads the newly synthesized DNA to correct errors.

### Question 5
# Brief Explanations:
The three building blocks (nucleotides) of DNA are a phosphate group, a deoxyribose sugar, and a nitrogen - containing base (adenine, thymine, cytosine, or guanine). These three components combine to form the basic unit of DNA.
# Answer:
The three building blocks of DNA are a phosphate group, a deoxyribose sugar, and a nitrogen - containing base (adenine, thymine, cytosine, or guanine).

### Question 6
# Brief Explanations:
A nucleotide is the structure that contains all three building blocks of DNA. A nucleotide is made up of one phosphate group, one deoxyribose sugar, and one nitrogen - containing base.
# Answer:
The nucleotide is the structure that contains all three building blocks of DNA.

### Question 7
# Brief Explanations:
In a human cell, DNA is located in the nucleus. The nucleus is the control center of the eukaryotic cell (and human cells are eukaryotic), and it houses the cell's genetic material in the form of chromatin (which is DNA associated with proteins).
# Answer:
DNA is located in the nucleus of a human cell.

### Question 8
# Brief Explanations:
Bacteria are prokaryotic cells, and in a bacteria cell, DNA is located in the nucleoid region. The nucleoid is a region within the prokaryotic cell where the circular DNA molecule is found, and it is not enclosed in a nuclear membrane like in eukaryotic cells.
# Answer:
DNA is located in the nucleoid of a bacteria cell.

### Question 9
# Brief Explanations:
In a virus, DNA (if the virus has DNA as its genetic material) is located within the viral capsid. The capsid is the protein - coat that encloses the viral genetic material (either DNA or RNA).
# Answer:
DNA is located in the capsid of a virus (if the virus has DNA as genetic material).

### Question 10
# Brief Explanations:
DNA has a negative charge. This is because of the phosphate groups in the DNA backbone. Each phosphate group has a negative charge, and since the DNA molecule has a repeating backbone of sugar - phosphate units, the overall charge of DNA is negative.
# Answer:
DNA has a negative charge.

### Question 11
# Brief Explanations:
A section of DNA that codes for a protein is called a gene. Genes are the basic units of heredity, and they contain the information necessary for the synthesis of a specific protein or a functional RNA molecule.
# Answer:
A section of DNA that codes for a protein is called a gene.

Sovi.AI - AI Math Tutor

QUESTION IMAGE

Question

Explanation:

Question 1

Answer:

Question 2