Sovi.AI - AI Math Tutor

Scan to solve math questions

QUESTION IMAGE

the proteins in biological organisms include 20 different kinds of amin…

Question

the proteins in biological organisms include 20 different kinds of amino acids. what is the minimum number of different types of trna molecules that must exist in the cell?
(a) 3
(b) 4
(c) 8
(d) 16
(e) 20
(f) 40
question 10
16 points
transcribe and translate the following dna sequence. (the amino acid sequence will be in a single letter code).
ataatactaattccttaggagatagtcatgacttcaattgatt
(a) mtcn
(b) mikessister
(c) yyd
(d) madmoney

Explanation:

Step1: Recall tRNA - amino - acid relationship

Each tRNA molecule is specific for one amino - acid.

Step2: Determine number of tRNA types

Since there are 20 different kinds of amino acids in biological organisms, the minimum number of different types of tRNA molecules must be equal to the number of different amino acids to ensure that each amino acid can be carried during translation. So, there must be 20 different tRNA molecules.

for Question 10:

Step1: Transcribe DNA to mRNA

The DNA sequence is ATAATACTAATTCCTTAGGAGATAGTCATGACTTGCAATTGATT. The complementary base - pairing rules for transcription are: A - U, T - A, C - G, G - C. The mRNA sequence is UAUU AUGAUUAAGGAAUCCUCUAUCAGUACUGAACGUUAACUAA.

Step2: Find start codon and translate

The start codon is AUG (in DNA it is ATG which transcribes to AUG in mRNA). Reading the mRNA in triplets from the start codon: AUG (Met - M), UAU (Tyr - Y), UAA (stop codon). So the amino - acid sequence is MTCN.

Answer:

E. 20