生物
細胞生物學、遺傳學、生態學與生命科學基礎。
-
1. the third enzyme you will be investigating is pepsin. like trypsin, …
12
-
the four types of listening that may be employed in interviews are mult…
comprehension, empathy, evaluation, and reaction
-
2.3 review 1. sequence list the types of organisms in order from the to…
1. Producer, primary consumer, secondary consumer, tertiary consumer 2. Energy is lost at each trophic level as heat and for metabolic processes. 3. A fire would lead to a narrowe…
-
a piston uses 32 j of energy to do work as 68 j of heat are added to th…
36
-
stability and change deciduous trees lose all their leaves each autumn.…
In autumn, the number of primary and secondary consumers may decrease due to reduced food availability from leaf - loss in deciduous trees. In seasons with more foliage, consumer …
-
in the formula used to solve problems related to the first law of therm…
B. heat
-
sep use mathematics a population of top predators consumes 7 kcal/m² pe…
700 kcal/m²
-
consider your data and consider this ph scale. identify the two ph clas…
Weakly acidic pH values, Neutral pH value
-
part iii: prince william sound gttcacagt tgagct gtggtattttacgcatagact t…
5. d. Which otter families are most closely related to each other? 7 a. (Answer depends on actual comparison of sequences. For example, if Cook Inlet's sequence is very similar to…
-
who among the following use a moderately scheduled interview? multiple …
C. All of these answers are correct
-
problem 2 having a crew of the international space station requires lif…
Life support
-
2) scientists are trying to study the relationship between the weight o…
a) A scatter - plot should be made by hand or using software (e.g., Excel, R, Python's Matplotlib) with the given data points. The non - linearity can be visually confirmed as the…
-
regarding internal career design, which of the following is something t…
if one's career steps are sustainable
-
which of the following is a definition of internal career design? a pla…
a plan for achieving goals and desires within a career
-
when should one evaluate their internal career design? quarterly never …
constantly
-
which of the following is necessary to create an internal career design…
to have a career in mind
-
check your progress 1. distinguish producers, consumers, and decomposer…
1. Producers make food via photosynthesis, consumers eat others, decomposers recycle dead matter. 2. Grass → Zebra → Lion shows energy flow from sun - to - producer - to - consume…
-
what is the first step of internal career design? to finish what one is…
to make a detailed list of career goals
-
why do historians consider the battle of saratoga to be the turning - p…
It convinced the French to join the war on the side of the Americans.
-
this is an excerpt from a letter written by george washington at valley…
A lack of supplies made it difficult for the army to function properly.
-
the painting of the battle of bunker hill shows a strategy used by brit…
American generals used guerrilla warfare; they used the landscape to their benefit and fought only when they held a significant advantage.
-
each organisms trophic level. grass - 1st tropic level grasshopper - pr…
Humans are omnivores and can be primary, secondary or tertiary consumers, occupying different trophic levels based on diet.
-
review the journal entry and then answer the question. monday, november…
to document necessary information about the voyage for its investors
-
review the journal entry and then answer the question. monday, november…
The writer provides a factual record of the ship's activities.
-
read the journal entry and then answer the question. monday, november 1…
authorities financing the expedition
-
general questions: 1. what gas must be present in order for organisms t…
1. Oxygen 2. Nitrite 3. Evaporation and condensation 4. Nitrogen cycle 5. Saltwater 6. Evaporation 7. Rain, snow, sleet, hail 8. Evaporation 9. Bacteria 10. Carbon, hydrogen, oxyg…
-
get 5 of 6 correct stage 1 beautiful music. each musician plays an inst…
C. The human body is made up of smaller parts working together. D. Organs are made of tissues.
-
read the newspaper article and then answer the question. a four - alarm…
D. a local news audience
-
question 19 (1 point) the basic purpose of hr management is to help the…
Question 19: C. Organization Question 20: A. External
-
9 which schedule would be used if you are a journalist investigating a …
nonscheduled interview
-
which of the following people routinely use loaded questions? multiple …
A. All of these answers are correct
-
sequencing information one reading skill is the ability to sequence inf…
10. Water 11. A strong gravitational field 12. Sunlight 13. Other animals
-
why is reverse transcriptase essential for a retrovirus to successfully…
It creates a complementary cDNA copy of the viral RNA genome.
-
1. how does the environment influence the type of natural selection?
The environment influences natural selection by creating selective pressures. Stable environments may lead to stabilizing selection, changing environments to directional selection…
-
8. describe what the revolutionaries did to the prisoners. 9. how many …
8. During the September massacres in 1792, revolutionaries attacked prisons in Paris. They killed many prisoners, including nobles, clergy, and common - criminals they suspected o…
-
allow hrm professionals to provide cost effective benefits to the emplo…
- Question 7: B. Human Resource Information Systems - Question 8: C. Technology - Question 9: B. Diversity
-
a strain of heat - tolerant pathogenic bacteria has acquired resistance…
The introduction of a bacteriophage that is known to attack a closely related bacterial species
-
1. how does the environment influence the type of natural selection?
The environment can cause stabilizing, directional, or disruptive selection. In a stable environment, stabilizing selection may be favored; in a changing environment, directional …
-
vocabulary development read each question and write the answer in the s…
The biosphere is the part of the Earth where all life exists, encompassing all ecosystems and the interactions between living organisms and their physical environment.
-
in regard to an internal career design, which of the following is the b…
beginning one's plan now
-
in regard to internal career design, when should one begin their plan? …
C. immediately
-
with what does a career plan start? negative feedback extracurricular a…
internal career design
-
in the space provided, write the letter of the description that best ma…
4. d 5. a 6. b 7. e 8. c
-
in regard to internal career design, what should be the driving factor …
something that one is passionate about
-
2 flow of energy in an ecosystem (continued) energy in an ecosystem sum…
| Type of Organism | Autotrophs | Consumers (herbivores, carnivores, scavengers, omnivores) | Decomposers | | ---- | ---- | ---- | ---- | | Other name(s) for this type | Producers…
-
in the space provided, write the letter of the term or phrase that best…
1. c. liquid water, temperatures between 10°C and 40°C, and a source of energy. 2. b. in the biosphere 3. b. tiny marine algae.
-
summarize three ways that organisms get energy by completing the table.…
1. H. Alligator 2. H. Squirrel 3. A. Maple tree 4. H. Whale 5. A. Moss 6. H. Siberian tiger 7. A. Daffodil 8. H. Rhinoceros 9. A. Dandelion 10. H. Rabbit 11. A. Tomato 12. H. Cock…
-
when an object has its motion changed, the cause is generally a. an ext…
A. an external force
-
25 true or false 0.7 points the secondary or second order neuron is the…
25. True 26. The receptor cells are capable only of producing a graded potential 27. Sour
-
any external force that acts against movement is called a. gravity b. e…
C. resistance
-
1. now lets make some observations using the negative control group. ik…
All of the time samples are dark black/blue in color.
-
22 multiple choice 0.7 points ____ is a process where we are consciousl…
22. C. Perception 23. A. Ear
-
question 9 internal audits are completed to: change information in the …
Question 9: review information to back up the charges sent to health insurance carriers Question 10: The right to medical care without payment
-
11. identify two parts of the digestive tract that may have ph values t…
C. Stomach Cavity, D. Small intestine
-
20 multiple choice 0.7 points which of the following statements about t…
20. Actin and myosin filaments stay the same size during contraction 21. visceral stimulation
-
2 flow of energy in an ecosystem new vocabulary autotroph biomass carni…
In a food chain, matter and energy move from one organism to another. A food chain is made of several steps; each organism in the food chain represents a step called a trophic lev…
-
how can journaling serve as a compass in decision - making? it guides y…
It guides you back to your core values and aspirations.
-
reactions w and x are basically the same chemical reaction. one utilize…
Reaction X takes longer to come to completion.
-
which of the following statements accurately describes the relationship…
Enzymes A and B function best at a narrow range of temperatures.
-
how might changing the ph of an enzymes natural environment affect its …
the chemical reaction would slow down or stop
-
what do high school students need to realize about their destinies? des…
They have the power to shape their own destinies.
-
beginning in the late 1600s, a philosophical movement known as the enli…
1. True 2. True 3. False 4. False
-
17 multiple choice 0.7 points fast glycolytic (type iib/iix) muscle fib…
C. Sprinting and explosive movements
-
the genetic makeup of many viruses supports the hypothesis that they ar…
double - stranded DNA virus.
-
3. what is hades theory about what happened at winter solstice, and wha…
3. In Greek mythology, Hades' abduction of Persephone led to the changing seasons. His threat if Persephone (his 'property') is not returned could be to keep the world in eternal …
-
viruses lack organelles and consist of genetic material encased in a pr…
support the theory that they arose as escaped fragments of organismal nucleic acids.
-
5. order the organs of the digestive systems to describe the pathway th…
A. Mouth B. Stomach C. Small intestine D. Large intestine
-
how can journaling be described as a tool for self - discovery? it is s…
It helps explore thoughts, emotions, strengths, and weaknesses.
-
what significant benefit does journaling offer in terms of personal dev…
It helps you understand your strengths and weaknesses.
-
what is the primary focus of journaling in terms of recording content? …
It can include thoughts, feelings, goals, and dreams.
-
question 7 what are some methods of minimizing distortion? clamping met…
- clamping metal in place - alternate welds - preheat - presetting work pieces - Question 8: True
-
what is the main purpose of journaling? sharing information with others…
reflecting on thoughts and aspirations
-
during the second industrial revolution, which building material became…
D. steel
-
add a comma or semicolon if needed. otherwise, submit the text without …
Journalist Horace Greeley founded the Liberal Republican Party, and he ran for the U.S. presidency in 1872 but died before the election results were finalized.
-
3) otter 073 raised this pup even though she was not the mother. what i…
By helping raise related pups, females increase the chances of their shared genes being passed on, which benefits the overall genetic fitness of the otter population. This is due …
-
a graph of $f(x)=x^{3}-3x^{2}-x + 5$ is shown. based on the graph, arna…
$x=-1.3$ $x = 1.6$
-
which invention was most important in revolutionizing the meat industry…
the refrigerator car
-
question 7 4 pts charles darwin made a number of observation and infere…
There is not enough information to determine which statement is an inference from the given options.
-
question 4 4 pts when scientists set out to test a hypothesis, it is of…
An organism was found with tissues made of something other than cells
-
a pathogenic bacterium invades a human respiratory system and begins to…
The last option: Like many other coordinated bacterial activities, pathogenic effects (such as coughing and sneezing) are mediated by quorum sensing.
-
teresa placed 1.0g of dry yeast in a 10% solution of dextrose and measu…
add units to the label of the independent variable
-
dichotomous key worksheet name common name scientific name common name …
1. Serinus canaria 2. Ostreidae 3. Canis lupus familiaris 4. Culicidae, Selachimorpha 5. Rosa 6. Mephitidae 7. Pinus 8. Aquila chrysaetos, Bos taurus 9. Bos taurus, Meleagris 10. …
-
which statement about denitrifiers is true? they fix atmospheric nitrog…
They release nitrogen into the atmosphere as nitrogen gas ($N_2$).
-
1. animal not an animal go to 11 go to 3 2. has wings no wings go to 6 …
1. No clear answer from the given table 2. No clear answer from the given table 3. No clear answer from the given table 4. No clear answer from the given table 5. No clear answer …
-
ninety percent of the cells in the human body are microbes—mostly proka…
None of the above options are correct.
-
what are the key factors in realizing ones dreams and achieving success…
acquiring knowledge and skills
-
what are the key factors in realizing ones dreams and achieving success…
All of the above options can be key factors. Each plays a unique and important role in the journey towards success and dream - realization.
-
what is the first step in pursuing a meaningful future? identifying one…
identifying one’s passion and dreams
-
what do high school students need to realize about their destinies? the…
They have the power to shape their own destinies.
-
what are essential traits that help individuals navigate lifes unexpect…
adaptability and flexibility
-
a. find and match the scientific names of the organisms common names us…
This is a biological identification task using a dichotomous key in the sub - field of Biology. To fully answer, one would need to have an organism's characteristics and follow th…
-
a. find and match the scientific names of the organisms common names: 1…
1. Serinus canaria 2. Meleagris gallopavo 3. Canis familiaris 4. Mephitis mephitis, Carcharodon carcharias 5. Rosa sylvestris 6. Mephitis mephitis 7. Pinus ponderosa 8. No clear a…
-
because of complications during delivery of identical twins, “baby a” i…
Baby B has eaten a less diverse diet and not acquired health - promoting bacteria in her microbiome.
-
question 1 4 pts jordan investigates two plant fertilizers. he has thre…
C. to determine whether either fertilizer had any effect
-
question 10 of 20 origin of life archaea eukarya proteobacteria lokiarc…
Mitochondria are derived from endosymbiotic bacteria.
-
based on the phylogenetic relationship and genes shared by the lokiarch…
lokiarchaeotes share similar cellular morphologies with certain eukaryotes.
-
osmosis, tonicity and water potential notes key idea: what are some fac…
1. Osmosis is the passive process of water entering and leaving the cell, flowing from high to low water - concentration areas. 2. Passive. 3. Because significant water movement t…
-
which statement about hyperthermophilic bacteria is true? they live in …
They live in conditions that may resemble those of Earth's early environments.
-
given what you know about cells and cell theory, explain where ribosome…
1. In the first cell after sperm and egg fusion, ribosomes come from the egg cell. 2. In the first ever cell, ribosomes likely originated from self - assembling organic molecules …
-
which type of bacteria photosynthesize using chlorophyll a, produced th…
C. Cyanobacteria